FastQCFastQC Report
Sat 11 May 2024
EGAF00000605477

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000605477
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences36477403
Total Bases1.5 Gbp
Sequences flagged as poor quality0
Sequence length42
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATC3777211.0354931243323435TruSeq Adapter, Index 6 (100% over 42bp)
CTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAAA1530020.41944323722826427No Hit
CCCGTGTGGTTGGTGCGCGGACACGCACTGCCTGCGTAACTA790700.21676433489522268No Hit
GTGGGGGGGAGGGCGCGCGACCCCGGTCGGCGCGCCCCGCTT640280.17552784665070592No Hit
GTCTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACA565400.1550000694950789No Hit
GTGTGGTTGGTGCGCGGACACGCACTGCCTGCGTAACTAGAG510020.13981806764039645No Hit
GTGGTTGGTGCGCGGACACGCACTGCCTGCGTAACTAGAGGG430310.11796618306407394No Hit
GGGGTGGGGGGGAGGGCGCGCGACCCCGGTCGGCGCGCCCCG394260.1080833523154047No Hit

[OK]Adapter Content

Adapter graph