FastQCFastQC Report
Sat 11 May 2024
EGAF00000718618

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000718618
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences31424457
Total Bases1.6 Gbp
Sequences flagged as poor quality0
Sequence length51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC1645970.5237862980416814TruSeq Adapter, Index 7 (100% over 50bp)
CTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCACCGAGGAT1448480.46094034337649814No Hit
CCAGGCTTGACCAGGCCTCCCCCAGACTCCACCAGCTGCACCTCACACTG592840.18865560668240028No Hit
CTGGGATAGAAGTTATTCAGCAGGCACACAACAGAGGCAGTTCCAGATTT531220.16904667596961181No Hit
CTTAGCCCTGGATTCCAAGGCCTATCCACTTGGTGATCAGCACTGAGCAC507200.16140294802866442No Hit
GTGAAAGATGAGCTGGAGGACCGCAATAGGGGTAGGTCCCCTGTGGAAAA485870.15461524124346843No Hit
TGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTC432530.1376412009283088No Hit
CCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCA431340.13726251498951914No Hit
GGAAGATGAAGACAGATGGTGCAGCCACAGTTCGTTTGATCTCTAGCTTG417280.13278829288919772No Hit
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG408360.12994973946566524TruSeq Adapter, Index 7 (100% over 49bp)
CTTATTCGTACACTTTTGGCCAGGGGACCAAGCTAGAGATCAAACGAACT402070.12794811378920565No Hit
CCCAGATCCACTGCCGCTGAACCTTGATGGGACCCCACTTTCTAAACTAG399090.12699980782484166No Hit
GTCGGAGTCCAGCACGGGAGGCGTGGTCTTGTAGTTGTTCTCCGGCTGCC362750.11543556663524845No Hit
GAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTA354880.11293114786358918No Hit
CTGGAACTGAGGAGCAGGTGGGGGCACTTCTCCCTCTAACACTCTCCCCT337180.10729859230344059No Hit
CACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAG335130.10664623417359288No Hit
CGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAA333430.10610525426103623No Hit
CAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGG331120.10537015802691516No Hit
GTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCAC329240.1047718978883231No Hit
CTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGGCGTTGT317910.10116642588287206No Hit

[OK]Adapter Content

Adapter graph