FastQCFastQC Report
Wed 8 May 2024
EGAF00000782625

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782625
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences143645
Total Bases21 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CATAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC12168984.71509624421316No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN45203.146646245953566No Hit
CATAGGGCACCACCACACTATGTCGAAAAGCGTTTCTGTCATCCAAATAC8290.5771171986494483No Hit
CATAGGGCACCACCACACTATGTCGAAAAGAGTTTCTGTCATCCAAATAC6120.4260503324167218No Hit
CATAGGGCACACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT4480.31187998189982247No Hit
CATAGGGCACCCCCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC4060.2826412335967141No Hit
CCTAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC3820.26593337742350937No Hit
CATAGGGCCCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT3440.23947927181593512No Hit
CATAGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT3090.2151136482300115No Hit
CATAGGGCACCACGACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC2790.19422882801350552No Hit
CATAGGGCACCACCACGCTATGTCGAAAAGTGTTTCTGTCATCCAAATAC2730.19005186397020432No Hit
CATAGGGCACCACAACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC2550.17752097184030075No Hit
CATAGGGCACTACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC2530.17612865049253368No Hit
CTAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT2460.17125552577534894No Hit
CATAGGGCACCACACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT2440.1698632044275819No Hit
CATAGGGCACCACCACACTATGCCGAAAAGTGTTTCTGTCATCCAAATAC2290.1594207943193289No Hit
CATAGGGCACCACCACACTTTGTCGAAAAGTGTTTCTGTCATCCAAATAC2080.14480142016777472No Hit
CATAGGGCACCACCACACTATGTCGAAAAGTGCTTCTGTCATCCAAATAC2040.1420167774722406No Hit
CATGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT1950.1357513314072888No Hit
CATAGGGCACCACTACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1920.13366284938563822No Hit
CATAGCGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1830.12739740332068641No Hit
CATAGGGCTCCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1820.12670124264680288No Hit
CATAGGGCACCACCACTCTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1730.12043579658185109No Hit
GATAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1730.12043579658185109No Hit
CATAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCGTCCAAATAC1690.11765115388631697No Hit
TATAGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1650.11486651119078284No Hit
CATAGGGCACCACCACAATATGTCGAAAAGTGTTTCTGTCATCCAAATAC1640.1141703505168993No Hit
CATCGGGCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1610.1120818684952487No Hit
CATAGGGACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATACT1540.10720874377806398No Hit
CATAGGCCACCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1520.10581642243029692No Hit
CATAGGGCCCCACCACACTATGTCGAAAAGTGTTTCTGTCATCCAAATAC1460.10163945838699573No Hit
CATAGGGCACCACCACACAATGTCGAAAAGTGTTTCTGTCATCCAAATAC1450.1009432977131122No Hit
CATAGGGCACCACCACACTATGTCGAAAAGTGATTCTGTCATCCAAATAC1440.10024713703922865No Hit
CATAGGGCACCACCACACTACGTCGAAAAGTGTTTCTGTCATCCAAATAC1440.10024713703922865No Hit

[OK]Adapter Content

Adapter graph