FastQCFastQC Report
Wed 8 May 2024
EGAF00000782626

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782626
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences143645
Total Bases21.1 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC9480065.99603188415887No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN45113.1403807998886144No Hit
AGGGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC41632.8981168853771453No Hit
AGAGATGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC41162.865397333704619No Hit
AGAGACGACAGTGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC28631.993108009328553No Hit
AGAGACGACAGGGCTTGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC28141.9589961363082598No Hit
AGAGACGACAGGGCTGTTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC20191.4055484005708516No Hit
AGAGTCGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC18341.2767586759023983No Hit
AGAGACGGCAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC17031.1855616276236556No Hit
AGAGCGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT8630.6007866615614884No Hit
AGACACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC6900.48035086497963725No Hit
AGAGACGACAGGGCTGGCTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC5830.4058616728740993No Hit
AGAGACGATAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC5010.34877649761564966No Hit
AGAGACGCAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT3940.27428730551011177No Hit
AGAGAGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT3890.27080650214069407No Hit
GGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC3490.2429600751853528No Hit
GAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT3320.23112534372933274No Hit
AGAGACGACAGGCCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC3130.2178982909255456No Hit
AGAGACGAAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT2900.2018865954262244No Hit
AGAGACGACAGGGCTGATTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC2840.1977096313829232No Hit
AGAGACGACAGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT2730.19005186397020432No Hit
AGGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT2720.1893557032963208No Hit
AGAGACGACGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT2180.15176302690661003No Hit
TGTATCAAAGAATGGTCCTGCACCAGTAATATGCATATTAAAACAAGATT2130.14828222353719236No Hit
AGAACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT1880.13087820669010408No Hit
AGAGACGACCGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC1810.12600508197291935No Hit
AGAGACGACAGGGCTGGTTGCCCAGGGCCCCCAGGCCTCTGATTCCTCAC1790.12461276062515228No Hit
AGAGACGACAGAGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC1740.12113195725573461No Hit
CGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC1680.11695499321243343No Hit
AGGGATGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC1530.10651258310418045No Hit

[OK]Adapter Content

Adapter graph