FastQCFastQC Report
Wed 8 May 2024
EGAF00000782627

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782627
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences99965
Total Bases14.8 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC50

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGC9038690.41764617616165No Hit
GCTGATTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT7330.7332566398239384No Hit
GCTGATTTGATGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT3250.32511378982643924No Hit
GCTGATTTGATGGAGTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT2870.28710048516980946No Hit
GCTGATTTGTGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT2670.2670934827189516No Hit
GCTGTTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT2380.2380833291652078No Hit
GCTGATTTGAGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT2150.21507527634672136No Hit
GCTGATTTGATGGCGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGC1950.19506827389586356No Hit
GCTGATTTGATGGAGTTGGCCATGGCCATGGAACCAGACAGAAAAGCGGC1910.191066873405692No Hit
GCTGATTTATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1900.1900665232831491No Hit
GCTGATTTGATGGGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1870.18706547291552045No Hit
GCGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1860.18606512279297754No Hit
GCTGATTTGATGGAGTTGACATGGCCATGGAACCAGACAGAAAAGCGGCT1570.15705496923923373No Hit
GCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAGGCGGC1400.1400490171560046No Hit
GCTATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1360.13604761666583304No Hit
GCTGATTTGATGGAGTTGGACATGGCCATGGAGCCAGACAGAAAAGCGGC1360.13604761666583304No Hit
GCTGATTTGCTGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGC1360.13604761666583304No Hit
GCTGCTTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGC1340.13404691642074726No Hit
GCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGGCAGAAAAGCGGC1240.12404341519531836No Hit
GTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1200.1200420147051468No Hit
CTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1190.1190416645826039No Hit
GCTGATTTGATGGATTGGACATGGCCATGGAACCAGACAGAAAAGCGGCT1110.1110388636022608No Hit
GCTGATTTGATGGAGTTGGACACGGCCATGGAACCAGACAGAAAAGCGGC1000.100035012254289No Hit

[OK]Adapter Content

Adapter graph