FastQCFastQC Report
Wed 8 May 2024
EGAF00000782629

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782629
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences141110
Total Bases21.2 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC58

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC6151343.592233009708735No Hit
CCAATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG6114243.32931755368152No Hit
CAATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTGT5120.3628375026575012No Hit
AGGAATCCCAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA4420.31323081284104604No Hit
AGGAATCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA4260.30189214088299904No Hit
AGAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA4250.30118347388562117No Hit
AGGATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA3770.2671674580114804No Hit
AGGAATCTCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC2850.20197009425271065No Hit
CCAATAGCATGCCACCTTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG2590.1835447523208844No Hit
CCAATAGCTGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTGT2510.17787541634186096No Hit
CCAATAGCGTGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG2430.17220608036283752No Hit
CCATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTGT2370.1679540783785699No Hit
AGGAATCCCAAAGTTCTAAACAAAAGAAATGCAGGGGGATACGGCCAGGC2200.15590673942314506No Hit
GGAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA2040.14456806746509815No Hit
CCAATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGCG2030.14385940046772022No Hit
AGGAATCCCAAAGTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCA2000.14173339947558644No Hit
TCAATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1930.1367727304939409No Hit
CCAATAGCATGCCACCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTGT1870.1325207285096733No Hit
AGCAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC1860.13181206151229538No Hit
AGGAATCCCAAAGTTCCAAACGATTGAGGCCGGTAGGTTTTCTGGGAAGG1750.12401672454113813No Hit
CCAATACATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTGT1730.12259939054638225No Hit
CTAATAGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1690.11976472255687053No Hit
CCAATAGTATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1570.11126071858833535No Hit
CCAATTGCATGCCACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1510.10700871660406774No Hit
AGGAATCCCAAAGTGCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC1510.10700871660406774No Hit
AGGAATCCCAAAGCTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC1510.10700871660406774No Hit
CCAATAGCATGCTACCCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1470.10417404861455602No Hit
TGGAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGC1460.1034653816171781No Hit
CCAATAGCATGCCAACCTACTTGCCCAGGACTCAAGCTGCTGGCCCTGTG1430.1013393806250443No Hit

[OK]Adapter Content

Adapter graph