FastQCFastQC Report
Wed 8 May 2024
EGAF00000782630

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782630
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences141110
Total Bases21.2 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC59

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT5611839.768974558854794No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT5335637.811636312096944No Hit
CCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTT6910.48968889518815106No Hit
CCCTTCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTT5980.4237828644320034No Hit
GATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGTG4600.3259868187938488No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGCGGGGGCCCTGGAAGGGGT4240.3004748068882432No Hit
CCCTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTT3840.27212812699312594No Hit
CACTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT3400.2409467791084969No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGAGGGGGCCCTGGAAGGGGT3110.22039543618453689No Hit
CCCTTCCCAGACAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2840.20126142725533275No Hit
GAATCTGCATTGCCATTTCCACTGCTGCCGGTGGGGGCCCTGGAAGGGGT2620.18567075331301822No Hit
CCCTTCCCAGAAAACCTACCAGGGCAGCTACGGCTTCCGTCTGGGCTTCT2600.18425341931826233No Hit
ACCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2600.18425341931826233No Hit
CCCTTCACAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2520.1785840833392389No Hit
CCCTTCCCAGAAATCCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2520.1785840833392389No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGACGGGGT2460.1743320813549713No Hit
CCTTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2450.17362341435759335No Hit
CCCTTCCCAGAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTT2390.16937141237332579No Hit
CCCTTCCCAGAAAAACTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2340.1658280773864361No Hit
GAATCTGCATAGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT2330.1651194103890582No Hit
GAATCTGCATTGTCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT2260.16015874140741265No Hit
AATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGTG2230.15803274041527884No Hit
GACTCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT2120.1502374034441216No Hit
CCCTTACCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT2070.14669406845723196No Hit
TAATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT2030.14385940046772022No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGC2000.14173339947558644No Hit
GAACTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGTG1790.12685139253064984No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGTGGGGGCCCTGGCAGGGGT1770.12543405853589398No Hit
GAATCTGCATTGCCATTTCCACTGCTGCAGGTGGCGGCCCTGGAAGGGGT1750.12401672454113813No Hit
GAATCTGCATTGCCCTTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT1740.1233080575437602No Hit
GAATCTGCATTGCCATGTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT1660.11763872156473673No Hit
CCCTTCCCAGAAAACCGACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT1640.11622138756998088No Hit
CCCTTCCCAGAAAACCTACCGGCCTCAATCGTTTGGAACTTTGGGATTCC1630.11551272057260292No Hit
CCCTTCCCAGAAACCCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT1580.11196938558571327No Hit
CCCTTCCCAGAAAACTTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT1560.11055205159095739No Hit
CCCTTCCCAGAAAACCTAGCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT1550.10984338459357948No Hit
CCCTTCTCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCT1480.10488271561193395No Hit
GAATCTGCATTGACATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT1440.10204804762242223No Hit
GAATCTGCATTGCAATTTCCACTGCTGCAGGTGGGGGCCCTGGAAGGGGT1430.1013393806250443No Hit

[OK]Adapter Content

Adapter graph