FastQCFastQC Report
Wed 8 May 2024
EGAF00000782757

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782757
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences619303
Total Bases66.1 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC32

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN18081529.196532230588257No Hit
CACTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT11241018.151050455108404No Hit
ATCAGCGTTTGCTTCATGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTA8486213.702823981153006No Hit
AACTTGAACCATCTTTTAACTCAGGTACTGTGTATATACTTACTTCTCCC441747.132857421972766No Hit
AACTTGAACCATCTTTTAACTCAGTTGCTAAGTGACCTCAGCCCCTTCC93221.5052405688330268No Hit
CACTGTGTGCATATCATGCTGAATTAAATAACTAATTCTTACTGGATTAT67521.0902579189831147No Hit
AACTTGAACCATCTTTTAACTCAGGTGACCTCAGCCCCTTCC64191.036487793535636No Hit
CACTGTGTGCATAACCTGCTGAATTAAATAACTAATTCTTACTGGATTAT61720.9966042470325511No Hit
CACCGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT61210.9883691827748292No Hit
CACTGTGTGCAAATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT57120.9223271968648626No Hit
GACTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT56290.9089250334650405No Hit
CACTGGGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT53740.8677497121764306No Hit
CACTGTGTGCATATCCTGCTTGCATTTGTAGTAAGTGCAT53690.8669423529354774No Hit
CACTGTGTGCATATCCTGATGAATTAAATAACTAATTCTTACTGGATTAT30590.49394238361512866No Hit
ATCAGCGTTTGCTTCATGGGCATTGACTTTCCAATGTGGT26140.4220874111702995No Hit
CACTGTATGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT22350.3608895807060518No Hit
CAGTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT20870.33699174717383895No Hit
CACTGTGTGCCTATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT20740.33489261314736085No Hit
AACTTGAACCATCTTTTAACTCAGCCTCTCTATGGGCAGTCGGTGATACG17230.2782159944324507ABI Solid3 Adapter B (95% over 24bp)
AACTTGAACCATCTTTTAACTCAGGAGTGACCTCAGCCCCTTCC15280.24672898403527835No Hit
CACTGTGCGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT14280.23058179921621566No Hit
CGCTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT14260.23025885551983438No Hit
CACTGTGTGCATATCCTTCTGAATTAAATAACTAATTCTTACTGGATTAT13400.21637227657544048No Hit
AACTTGAACCATCTTTTAACTCAGCCCCTTCCAGATCGGAAGAGCGTCGT13340.21540344548629667No Hit
CACTGTGTGCATATCCTGCTGGCATTTGTAGTAAGTGCAT10890.17584284267959302No Hit
AACTTGAACCATCTTTTACCTCAGCCCCTTCCAGATCGGAAGAGCGTCGT10730.173259293108543No Hit
AACTTGAACCATCTTTTAACTCAGAAGTGACCTCAGCCCCTTCC10320.16663894733272727No Hit
AACTTGAACCATCTTTTAACTCAGTTGCTAAGTGACCTCAGCCCCTTCCA7520.12142682983935166No Hit
ATCAGCGTTTGCTTCATGGAAAATTTTTTCCTAGTCTTGCTAGTTCTTAC6550.10576406056486082No Hit

[OK]Adapter Content

Adapter graph