FastQCFastQC Report
Wed 8 May 2024
EGAF00000782758

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782758
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences526941
Total Bases65 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ACCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA6837312.975456455276776No Hit
GCGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG6212411.789555187392896No Hit
ATGCACTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA512189.71987376195817No Hit
GGAAGGGGCTGAGGTCACTCACCTGGAGTGAGCCCTGCTCCCCCCTGGCT449618.532454297539953No Hit
GCGCGAAGTGATCCAGAACTGAAGAGACTAGCCCCAGGCA349786.637934797254341No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN320556.083223738521011No Hit
ACCACAGTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA127342.4165893335306987No Hit
CCCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA53551.0162428051717365No Hit
ACCACATTGAAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA51670.9805651866148202No Hit
ATGCACTTAGTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA44710.8484820881275134No Hit
ACCACATTGGAAAGTCACTGCCAAATGTCCTAGAAGATGAAGTATATGAA43670.8287455331811342No Hit
GCGCGAAGTGATCCAGAGCCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG39160.7431572035578936No Hit
CTGCACTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA36050.6841373132855482No Hit
ACCACATCGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA34600.6566200011006925No Hit
ATGCAATTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA33640.6384016426886501No Hit
ATGCACTTACTACCAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA33170.6294822380494212No Hit
GCGCGAAGTGATCCAGAACAAGAGACTAGCCCCAGGCA30360.5761555847808388No Hit
ATGCACGTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA29970.5687543766759466No Hit
ATGCACTTACTACAAATGCCAGCTCTTAAGGAAGGACAAGGTGGGGAAAA29510.5600247466035096No Hit
GCGCGAAGTGATCCAGACCCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG29410.5581270009355886No Hit
GCGCGAAGTGATCCAGAACTGAAGAGACTAGCCCCAGTCA25310.4803194285508245No Hit
ATGCACTTACTACAAATGAAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA23490.44578045739466093No Hit
GCGCGAAGTGATCCAGAACTGAAGAGACTAGCCCCAGGCAAGATCGGAAG22240.4220586365456474No Hit
ATGCCCTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA20010.3797389081510074No Hit
GCGCGAAGTGATACAGAACTGAAGAGACTAGCCCCAGGCA19050.3615205497389651No Hit
ATGCACTTACTACAAGTGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA18990.36038190233821243No Hit
GCGCGAAGTGATCCAGAGCTGAAGAGACTAGCCCCAGGCA18040.34235331849296224No Hit
GCGCGAAGTGATCCAGAACTGAAGAGACTAGTCCCAGGCA17310.32849977511713835No Hit
GCGCGAACTGATCCAGAACTGAAGAGACTAGCCCCAGGCA16040.30439840513454064No Hit
CGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCGC15190.2882675669572115No Hit
ATGCACTTACTACAAATTCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA14400.273275376180635No Hit
GCGCGAAGTGATCCAGACCTGAAGAGACTAGCCCCAGGCA13950.2647355206749902No Hit
ACCACATTGGAAAGTAAATGCCAAATGTCCTAGAAGATGAAGTATATGAA12160.2307658732192029No Hit
GCGCGAAGGGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG11480.2178612026773396No Hit
ATTCACTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA11150.21159864197320002No Hit
ATGCACTTACTACAAATGCAACCTCTTAAGGAAGGACAAGGTGGGGAAAA10940.20761337607056576No Hit
CCCACAGTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA10340.19622690206303933No Hit
GCGCGAAGTGATCCAGACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCGC10250.19451893096191036No Hit
GGAAGGGGCTGAGGTCACTTAGCAACTGAGTTAAAAGATGGTTCAAGTT9790.1857893008894734No Hit
GCCCGAAGTGATCCAGAACTGAAGAGACTAGCCCCAGGCA9640.1829426823875918No Hit
ACCACAGTGAAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA9510.18047561301929438No Hit
GCGCGAAGTGAGCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG8880.1685198153113916No Hit
ATGCACTTACTACAAATGCAAGCAGGATATGCACACAGTG8620.1635856765747968No Hit
ACCACATTGGCAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA7970.1512503297333098No Hit
GCGCGAAGTCATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG7610.14441844532879394No Hit
GCGCGAAGTGATCCAGAAGAGACTAGCCCCAGGCA7200.1366376880903175No Hit
ATGTACTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGTGGGGAAAA7140.13549904068956486No Hit
CGCGAAGTGATCCAGAACTGAAGAGACTAGCCCCAGGCA6640.1260103123499595No Hit
GCGCCAAGTGATCCAGAACTGAAGAGACTAGCCCCAGGCA6470.12278414471449364No Hit
GCGAGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG6360.12069662447978047No Hit
ATGCACTTACTACAAATGCAAGCTCTTAAGGAAGGACAAGGCGGGGAAAA6320.11993752621261204No Hit
GCGCGAAGTGATCCAGAACCGGGCCCCAGGCACCCAGAGGCCGCGAGCGC6310.11974775164581992No Hit
GGGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG6050.11481361290922514No Hit
GCGCGAAGTGATCCAGAACCAAGAGACTAGCCCCAGGCA5930.11253631810771984No Hit
ACCACAGCGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAA5870.1113976707069672No Hit
GGAAGGGGCTGAGGGCACTCACCTGGAGTGAGCCCTGCTCCCCCCTGGCT5800.11006924873942245No Hit
ACCACAGTGGAAAGTCACTGCCAAATGTCCTAGAAGATGAAGTATATGAA5700.10817150307150136No Hit
GCGGGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG5640.10703285567074872No Hit
GCGCGAGGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG5590.10608398283678817No Hit
GCCCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG5570.10570443370320397No Hit

[OK]Adapter Content

Adapter graph