FastQCFastQC Report
Wed 8 May 2024
EGAF00000782759

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782759
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences526941
Total Bases65.8 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATCAGCGTTTGCTTCATGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTA10502519.931073877341106No Hit
TGCCTGGGGCTAGTCTCTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG6491412.319026228742876No Hit
CACTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT6082811.543607348830324No Hit
AACTTGAACCATCTTTTAACTCAGGTACTGTGTATATACTTACTTCTCCC5326610.108532074748407No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCACTTCGCGC319366.060640565072751No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN314985.977519304817807No Hit
TGACTGGGGCTAGTCTCTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG51610.9794265392140675No Hit
TGCCTGGGACTAGTCTCTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG43810.8314023771162237No Hit
TGCCTGGGGCTAGTCTCTTGCTGCTGCCGCGGGAGGTGCTGCGCTCGCGG40790.7740904579450071No Hit
CACTGTGTGCATATCATGCTGAATTAAATAACTAATTCTTACTGGATTAT36070.6845168624191323No Hit
CACTGTGTGCATAACCTGCTGAATTAAATAACTAATTCTTACTGGATTAT34830.660984816136911No Hit
CACCGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT33970.6446642033927896No Hit
GACTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT31740.6023444749981497No Hit
CACTGTGTGCAAATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT31580.599308081929476No Hit
CACTGGGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT29200.5541417350329544No Hit
TGCCTGGGGCTAGTCTCTTGTTCTGGATCACTTCGCGC27930.5300403650503567No Hit
TGACTGGGGCTAGTCTCTTCAGTTCTGGATCACTTCGCGC24430.46361926667311903No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCACTTCGCGCAGATCGGAAG23980.4550794111674742No Hit
TGCCTGGGGCTAGTCTCTTCAGCTCTGGATCACTTCGCGC19870.3770820642159179No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGTATCACTTCGCGC17650.33495211038807005No Hit
CACTGTGTGCATATCCTGATGAATTAAATAACTAATTCTTACTGGATTAT16140.30629615080246175No Hit
TGCCTGGGACTAGTCTCTTCAGTTCTGGATCACTTCGCGC15600.29604832419568794No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCAGTTCGCGC14570.2765015438161008No Hit
TGCCTGGGGCTAGTCTCTTCAGGTCTGGATCACTTCGCGC12920.2451887402954031No Hit
CACTGTGTGCCTATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT11580.21975894834526066No Hit
CAGTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT11560.21937939921167646No Hit
CACTGTATGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT11120.2110293182728237No Hit
AACTTGAACCATCTTTTAACTCAGTTGCTAAGTGACCTCAGCCCCTTCC9550.18123471128646282No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCACTTCGGGC8890.1687095898781837No Hit
CACTGTGTGCATATCCTGCTTGCATTTGTAGTAAGTGCAT8150.15466627193556773No Hit
CGCTGTGTGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT8030.15238897713406244No Hit
CACTGTGCGCATATCCTGCTGAATTAAATAACTAATTCTTACTGGATTAT7690.1459366418631308No Hit
CACTGTGTGCATATCCTTCTGAATTAAATAACTAATTCTTACTGGATTAT7390.14024340485936757No Hit
CTCAGCGTTTGCTTCATGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTA6720.12752850888429634No Hit
TGCCTGGGGCTAGTATCTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG6580.12487166494920685No Hit
TGCCTGGGGCTAGTCTCTTCTGGATCACTTCGCGC6540.1241125666820384No Hit
TGCCTGGGGCTAGACTCTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG6440.12221482101411733No Hit
ATCAGCGTTTGCTTCCTGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTA6100.11576248574318568No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCACTTCGCG6070.11519316204280934No Hit
TGCCTGGGGCTAGTCTCTTCAGTTCTGGATCACTTGGCGC5710.10836127763829348No Hit
TGCCTGGGGCTAGTCTCTTGGTTCTGGATCACTTCGCGC5350.1015293932337776No Hit

[OK]Adapter Content

Adapter graph