FastQCFastQC Report
Wed 8 May 2024
EGAF00000782761

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782761
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences359972
Total Bases48.7 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC55

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTAGCAACCCCTGCTTGTTCTGACTCCTGTTTTTTGTACAGATTCCTTCT9304025.84645472425633No Hit
GCCCACCTGTGATCTCTTCCAGAGTCTCAAACACTTGGAGCTGCTCTGGC7388520.525207516140146No Hit
AGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC5932316.479892880557376No Hit
GCCCACCTGTGATCTCTTCCGCCCCACTCCCCACCATGAATG105602.9335614992277175No Hit
GCCCACCTGTGATCTCTTCCGCCCGACGCCCCCCCACCGCGCCACTCCCC29330.8147855944351228No Hit
GCCCACCTGTGATCTCTTCCGCCCGACGCCCCCCCACCACTCCCCACCAT28700.7972842332181392No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN27190.7553365261742581No Hit
AGAGATGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC25960.7211672018934806No Hit
GCCCACCTGTGATCTCTTCCGCCCACTCCCCACCATGAATG25590.7108886246708077No Hit
AGGGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC25410.7058882357516696No Hit
AGAGACGACAGTGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC20340.5650439478626116No Hit
AGAGACGACAGGGCTTGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC17620.4894825153067461No Hit
AGAGTCGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC12610.3503050237240674No Hit
GCCCACCTGTGATCTCTTCCGCCCGACGCCCCCCCACTCCCCACCATGAA11900.33058126743191135No Hit
AGAGACGGCAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC11080.3078017179113931No Hit
AGAGACGACAGGGCTGTTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC10860.3016901314546687No Hit
GCCCACCTGTGATCTCTTCCGCCCGACTCCCCACCATGAATG9620.2672430077894947No Hit
GCCCACCTGTGATCTCTTCCGCCCCACTCCCCACCATGAATGAGATCGGA8820.2450190570377696No Hit
GCCCACCTGTGATCTCTTCCCACTCCCCACCATGAATG7020.19501516784638806No Hit
TTAGCAACCCTGCTTGTTCTGACTCCTGTTTTTTGTACAGATTCCTTCTG6430.17862500416699076No Hit
GCCCACCTGTGATCTCTTCCAGAGTCTCAAACACTTGGAGCTGCCCTGGC5570.15473425710888625No Hit
GCCCACCTGTGATCTCTTCCGGCCCCACTCCCCACCATGAATG5350.14862267065216184No Hit
AGAGCGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACT5110.1419554854266443No Hit
AGACACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCAC4380.12167613036569512No Hit
GCCCACTGTGATCTCTTCCAGAGTCTCAAACACTTGGAGCTGCTCTGGCT4360.12112053159690198No Hit
TAGCAACCCCTGCTTGTTCTGACTCCTGTTTTTTGTACAGATTCCTTCTG4220.11723134021535007No Hit
TAAGCAACCCCTGCTTGTTCTGACTCCTGTTTTTTGTACAGATTCCTTCT4210.11695354083095352No Hit
GCCCACCTGTGATCTCTTCCGCCACTCCCCACCATGAATG4200.11667574144655696No Hit
GCCCACCTGTGATCTCTTCCACTCCCCACCATGAATG4190.11639794206216038No Hit
GCCCACCTGTGATCTCTTCCGCCCGACGCCCCCCCACCGCGCCCCGCGCC4030.11195315191181536No Hit
TTAGCACCCCTGCTTGTTCTGACTCCTGTTTTTTGTACAGATTCCTTCTG3990.1108419543742291No Hit
GCCCCCTGTGATCTCTTCCAGAGTCTCAAACACTTGGAGCTGCTCTGGCT3880.1077861611458669No Hit

[OK]Adapter Content

Adapter graph