FastQCFastQC Report
Wed 8 May 2024
EGAF00000782762

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782762
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences106375
Total Bases15.9 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT8813382.85123384253819No Hit
CCATGGACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT7600.7144535840188014No Hit
CCATGGAACCAGACAGAAAGGCGGCTGTTAGTCACTGGCAGCAACAGTCT6100.5734430082256169No Hit
CCATGGAACAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT5640.5301997649823736No Hit
CCATGGAACCAGCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT4800.4512338425381904No Hit
CCATGGAACCGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT4350.408930669800235No Hit
CCATGGAACCAGAAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT4050.3807285546415981No Hit
CCATGGAACCGGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT3910.3675675675675676No Hit
CCATGGAACCAGACGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT3780.3553466509988249No Hit
CATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT3630.34124559341950644No Hit
CCATGGAGCCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT3480.32714453584018804No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGCCACTGGCAGCAACAGTCT3150.29612220916568743No Hit
CCATGGAACCAGGCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT3010.2829612220916569No Hit
CCATGGAACCAACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2820.2650998824911868No Hit
CCATGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2770.26039952996474736No Hit
CCATGGAACTAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT2620.2462984723854289No Hit
CCATGGCACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT2370.22279670975323151No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN2300.21621621621621623No Hit
CCTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2260.21245593419506464No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGCCT2180.20493537015276145No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGACT2060.1936545240893067No Hit
CCGTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT2020.1898942420681551No Hit
CCATGGAACCAGACAGAATAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1960.18425381903642774No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGACACTGGCAGCAACAGTCT1800.1692126909518214No Hit
CCATGGAACCAGACAGAAAAGCGGCTGCTAGTCACTGGCAGCAACAGTCT1760.1654524089306698No Hit
CCATGGAACCAGACTGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1680.15793184488836662No Hit
CCATGGAACCAGACAAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT1550.14571092831962398No Hit
CCATGGAACCAGCCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1540.14477085781433607No Hit
CCATGGAACCAGATAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1530.1438307873090482No Hit
CCATGGAACCAGACAGATAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1490.14007050528789658No Hit
CCATGGAACCAGACAGGAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1440.1353701527614571No Hit
CCATGGAACCAGACAGAAAAGCGGCCGTTAGTCACTGGCAGCAACAGTCT1410.1325499412455934No Hit
CCAGGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1370.12878965922444183No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCGCTGGCAGCAACAGTCT1320.12408930669800236No Hit
CCATGGAACCAGACGGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1300.12220916568742655No Hit
CCATGGAACCAGACAGTAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1270.11938895417156285No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACCGGCAGCAACAGTCT1230.11562867215041128No Hit
CCATGGAACCAGACAGCAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1210.11374853113983549No Hit
CCCTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1150.10810810810810811No Hit
CCAGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT1100.10340775558166863No Hit
CCATGGTACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1070.10058754406580493No Hit

[OK]Adapter Content

Adapter graph