FastQCFastQC Report
Wed 8 May 2024
EGAF00000782766

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000782766
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences69303
Total Bases10.4 Mbp
Sequences flagged as poor quality0
Sequence length35-151
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT5648181.49863642266568No Hit
CCATGGACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT4030.5815044081785782No Hit
CCATGGAACCAGACAGAAAGGCGGCTGTTAGTCACTGGCAGCAACAGTCT4020.5800614692004675No Hit
CCATGGAACAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT3770.5439879947477021No Hit
CCATGGAACCGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2960.4271099375207423No Hit
CCATGGAACCAGCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2950.4256669985426316No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN2930.42278112058641043No Hit
CCATGGAACCAGAAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2650.38237882919931315No Hit
CCATGGAACCGGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT2480.35784886657143267No Hit
CCATGGAACCAGACGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2430.3506341716808796No Hit
CCATGGAGCCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT2280.3289900870092204No Hit
CATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT2010.29003073460023376No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGCCT2010.29003073460023376No Hit
CCATGGAACCAGGCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1970.2842589786877913No Hit
CCATGGCACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1850.26694371095046393No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGCCACTGGCAGCAACAGTCT1810.26117195503802143No Hit
CCATGGAACCAACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT1790.2582860770818002No Hit
CCATGGAACTAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1720.2481855042350259No Hit
CCATGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT1660.2395278703663622No Hit
CCATGGAACCAGACAGAATAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1590.2294272975195879No Hit
CCTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT1550.22365554160714546No Hit
CCATGGAACCAGACTGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1430.20634027386981804No Hit
CCATGGAACCAGACAGCAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1170.16882386043894204No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGACACTGGCAGCAACAGTCT1140.1644950435046102No Hit
CCATGGAACCAGACAGAAAAGCGGCCGTTAGTCACTGGCAGCAACAGTCT1130.16305210452649957No Hit
CCGTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1110.16016622657027835No Hit
CCATGGAACCAGACAGGAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1110.16016622657027835No Hit
CCATGGAACCAGACAGATAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1090.15728034861405712No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGACT1080.15583740963594647No Hit
CCATGGAACCAGATAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT1020.1471797757672828No Hit
CCATGGAACCAGACAAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT990.14285095883295096No Hit
CAAATAAGCAGCAGGAGAAAGCCCCCCTACTGCTCACCTGGAGGGCCACT970.1399650808767297No Hit
CCATGGAACCAGACAGAAAAGCGGCTGCTAGTCACTGGCAGCAACAGTCT950.13707920292050849No Hit
AACCATGACCACAAAATGGAGAAACTAGGCCTTGGCTTAGATGATGAGAG930.13419332496428726No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACCGGCAGCAACAGTCT910.13130744700806604No Hit
CCATGGAAGCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT850.12264981313940233No Hit
CCCTGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT850.12264981313940233No Hit
CCATGGAACCAGACAGTAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT840.12120687416129171No Hit
CCATGGAACCAGCCAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT840.12120687416129171No Hit
CCATGGGACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT840.12120687416129171No Hit
CCAGGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT840.12120687416129171No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCGGCAACAGTCT820.11832099620507049No Hit
CCATGGAACCAGACAGAAAAGCGGCTGTTAGTCGCTGGCAGCAACAGTCT760.10966336233640679No Hit
CCAGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTT750.10822042335829618No Hit
CCATGGAACCCGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT740.10677748438018557No Hit
CCATGGAACCAGACAGAGAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT700.10100572846774308No Hit
CCATGGAACCAGACGGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCT700.10100572846774308No Hit

[OK]Adapter Content

Adapter graph