FastQCFastQC Report
Fri 17 May 2024
EGAF00000888768

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000888768
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences101903147
Total Bases7.7 Gbp
Sequences flagged as poor quality0
Sequence length76
%GC53

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA6392320.6272936791638044No Hit
CTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGT6129650.6015172426421728No Hit
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG5495450.5392816769436963No Hit
CAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAG3558140.3491688043746088No Hit
CTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATC3278230.3217005653417161No Hit
CTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAAATGGACCTT2820470.2767794796366789No Hit
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT2608210.2559498972097496No Hit
CTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACG2549440.2501826562824404No Hit
CTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGC2521720.24746242625853349No Hit
CCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCC2509050.24621908879811139No Hit
GGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCA2136630.20967262178860874No Hit
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT2065320.20267480061238932No Hit
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG2020360.1982627680772214No Hit
GTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGA1936920.19007460093455208No Hit
CTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGA1728820.16965324927600126No Hit
CTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGT1612470.15823554497291434No Hit
GCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT1514780.14864899118375607No Hit
GGGGTCTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCG1476680.14491014688682774No Hit
GCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGG1474530.14469916223490134No Hit
CTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATC1466300.14389153261380633No Hit
TGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGAC1458840.14315946493781984No Hit
GGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAG1456720.14295142425778076No Hit
CGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCC1445670.1418670612792753No Hit
GGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCG1366790.13412637786348247No Hit
GCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT1350690.13254644628394055No Hit
CTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATC1349100.13239041577391128No Hit
CCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATC1291150.1267036434115229No Hit
GTCTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAAATGGACC1224930.12020531613218971No Hit
CGGGAGTTTTGACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCT1217850.11951053876677625No Hit
CTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGA1203570.11810920814839998No Hit
GGAGTTTTGACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTA1188750.11665488603605147No Hit
GGGAGTTTTGACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTT1142190.11208584166689181No Hit
CGGGGTCTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGC1138510.11172471444871078No Hit
GGGTGACTTCGCAGGCGTAGACTTTGTGTTTCTCGTAGTCTGCTTTGCTC1125020.11040090842336793No Hit
CGGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGC1111940.10911733668048544No Hit
CTCAACTTTCTTGTCCACCTTGGTGTTGCTGGGCTTGTGATTCACGTTGC1053450.10337757282412485No Hit

[OK]Adapter Content

Adapter graph