FastQCFastQC Report
Fri 3 May 2024
EGAF00000922554

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000922554
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences40563789
Total Bases4 Gbp
Sequences flagged as poor quality0
Sequence length101
%GC49

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCGTACTGAGCAGGATTACCATGGCAACAACACATCATCAGTAGGGTAA1576120.3885534460303992No Hit
CCTCAGCCAAGCACATACACCAAATGTCTGAACCTGCGGTTCCTCTCGTA1099960.2711679621447592No Hit
CGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAA1087510.2680987222372151No Hit
GTCATAATCCCACAGATGGTAGCTTCGCCCCATTGGCTCCTCAGCCAAGC964310.23772680604368593No Hit
CGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTGGCCGCCACAAGCCA894900.2206154854025101No Hit
CTTTTCTGACACCTCCTGCTTAAAACCCAAAAGGTCAGAAGGATCGTGAG786540.19390200456865606No Hit
ACCGAGGCTCCGCGGCGCTGCCGTATCGTTCCGCCTGGGCGGGATTCTGA781010.19253871969406014No Hit
CTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCGCCAAGCC761350.18769203241837196No Hit
CTTGGCTGTGGTTTCGCTGGATAGTAGGTAGGGACAGTGGGAATCTCGTT757820.18682179813133334No Hit
GCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCCTGCTTAAAACCCAA750260.1849580669103668No Hit
TGTCTCTTCACCGTGCCAGACTAGAGTCAAGCTCAACAGGGTCTTCTTTC748670.18456609169325874No Hit
GTGGGAATCTCGTTCATCCATTCATGCGCGTCACTAATTAGATGACGAGG743000.1831682932775338No Hit
GTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTGAATTCTGCTTCAC742230.18297846880132426No Hit
GGATTACCATGGCAACAACACATCATCAGTAGGGTAAAACTAACCTGTCT711490.17540028127056867No Hit
CCTGTGGTAACTTTTCTGACACCTCCTGCTTAAAACCCAAAAGGTCAGAA685900.16909169900277315No Hit
CCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCCTGCTTAAA680240.167696365839986No Hit
CTGACTTAGAGGCGTTCAGTCATAATCCCACAGATGGTAGCTTCGCCCCA674100.1661827005361851No Hit
CATACACCAAATGTCTGAACCTGCGGTTCCTCTCGTACTGAGCAGGATTA648950.15998258939765217No Hit
GGTAGCTTCGCCCCATTGGCTCCTCAGCCAAGCACATACACCAAATGTCT645630.15916412542230707No Hit
CTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGG632290.15587547800329996No Hit
GAAGGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGTACTGAAAATCA617910.15233044427876302No Hit
CCGACATCGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTGGCCGCCA610060.15039522072260064No Hit
AGCACATACACCAAATGTCTGAACCTGCGGTTCCTCTCGTACTGAGCAGG606750.14957922200019333No Hit
GTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCGCCAAGCCCGTTC604710.14907631040088487No Hit
GGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTA572620.14116531372352814No Hit
GTTCCGCCTGGGCGGGATTCTGACTTAGAGGCGTTCAGTCATAATCCCAC565600.13943470616120207No Hit
CCAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGT552200.1361312672245682No Hit
ACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCGCCAAGC542410.13371778459847525No Hit
CTTCGCCCCATTGGCTCCTCAGCCAAGCACATACACCAAATGTCTGAACC539760.13306449256996186No Hit
ACCAAATGTCTGAACCTGCGGTTCCTCTCGTACTGAGCAGGATTACCATG528600.13031327029139214No Hit
GCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGGTAGGGACA524620.12933209962215314No Hit
CACAGATGGTAGCTTCGCCCCATTGGCTCCTCAGCCAAGCACATACACCA524040.12918911495176155No Hit
GAACAATCCAACGCTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCG517290.12752506921875567No Hit
CAACACATCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAAC515920.12718732956627893No Hit
GGAAGAGCCGACATCGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTG511830.12617904111472425No Hit
TGGGAATCTCGTTCATCCATTCATGCGCGTCACTAATTAGATGACGAGGC510860.12593991157975898No Hit
GGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGTACTGAAAATCAAGA499560.12315417576006027No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC484310.11939466502993593No Hit
GTCAGAAGGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGTACTGAAA476810.11754572532659609No Hit
CGTTCCGCCTGGGCGGGATTCTGACTTAGAGGCGTTCAGTCATAATCCCA468840.1155809187351803No Hit
CGGCCGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGT466480.11499911904186268No Hit
CGCTATGAACGCTTGGCCGCCACAAGCCAGTTATCCCTGTGGTAACTTTT466120.11491036993610237No Hit
CATAATCCCACAGATGGTAGCTTCGCCCCATTGGCTCCTCAGCCAAGCAC462830.11409930171957063No Hit
CCGAGGCTCCGCGGCGCTGCCGTATCGTTCCGCCTGGGCGGGATTCTGAC460850.11361118163788891No Hit
CTGAACGCCACTTGTCCCTCTAAGAAGTTGGGGGACGCCGACCGCTCGGG455700.11234157637492889No Hit
CGTATCGTTCCGCCTGGGCGGGATTCTGACTTAGAGGCGTTCAGTCATAA452030.11143682854676126No Hit
GAAGGATCAAAAAGCGACGTCGCTATGAACGCTTGGCCGCCACAAGCCAG443470.10932657203201604No Hit
GCCGTATCGTTCCGCCTGGGCGGGATTCTGACTTAGAGGCGTTCAGTCAT443360.10929945424970039No Hit
CACCAAATGTCTGAACCTGCGGTTCCTCTCGTACTGAGCAGGATTACCAT436270.1075515899168098No Hit
CGGGGGTGCGTCGGGTCTGCGAGAGCGCCAGCTATCCTGAGGGAAACTTC436000.10748502808748957No Hit
GTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTAT432790.1066936818944601No Hit
CAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCCTGCTTAAAACC426330.10510112849665006No Hit
CAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGTA425420.10487679047931149No Hit
CTCAGCCAAGCACATACACCAAATGTCTGAACCTGCGGTTCCTCTCGTAC422310.1041100968156599No Hit
GTCGGGTCTGCGAGAGCGCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC420820.1037427741279297No Hit
GACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCGCCAAG406380.10018294888576607No Hit

[OK]Adapter Content

Adapter graph