FastQCFastQC Report
Sat 11 May 2024
EGAF00000922555

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00000922555
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences27937000
Total Bases2.8 Gbp
Sequences flagged as poor quality0
Sequence length101
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1439530.5152772309124101No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCC1285030.45997422772667074No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGT1255800.44951140065146583No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTC1253510.4486916991802985No Hit
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTT1181430.4228907899917672No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAA1100450.3939041414611448No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCG952910.34109245803056876No Hit
GGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTA915030.3275333786734438No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATG913700.3270573075133336No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGT735350.2632172387872713No Hit
GCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGC721600.2582954504778609No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTT717020.25665604753552634No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGA693010.248061710276694No Hit
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCT678980.2430396964598919No Hit
GGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGC663330.23743780649318108No Hit
GCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCG655080.23448473350753482No Hit
GCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCC642690.23004975480545511No Hit
GCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCC640710.2293410172889No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATT626460.22424025485914736No Hit
GGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAG579740.20751691305437234No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGA541680.1938934030139242No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGG524740.1878297598167305No Hit
TGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTC515760.1846153846153846No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTC509710.18244979775924403No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCA482800.1728174106024269No Hit
GCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCA475680.17026881912875397No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGA465060.16646740881268568No Hit
GTGCGGACCAGGGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAAG463990.16608440419515338No Hit
GCAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCA461430.16516805669900134No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCT448130.16040734509789883No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCA447960.1603464938969825No Hit
CGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGA433320.15510613165336293No Hit
GGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGC421180.15076064001145434No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAA410710.1470129219314887No Hit
GGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTC402530.14408490532269036No Hit
GGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCA398360.14259226115903642No Hit
CCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGG396660.14198374914987294No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATA390030.13961055231413538No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGT383390.137233775995991No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTC381320.13649282313777428No Hit
CTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCC359350.12862870028993806No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCG351380.1257758528116834No Hit
GCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGAT351340.12576153488205605No Hit
GCCGACTTAGAACTGGTGCGGACCAGGGGAATCCGACTGTTTAATTAAAA346970.12419730107026525No Hit
CCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTC338930.12131939721516267No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT337090.1206607724523034No Hit
GGGGGGAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGC333570.11940079464509432No Hit
GTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGG328450.11756809965279019No Hit
GCGGCTTAATTTGACTCAACACGGGAAACCTCACCCGGCCCGGACACGGA323070.11564233811790815No Hit
GGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGT316230.11319397215162688No Hit
CAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGG316170.11317249525718581No Hit
GGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGG308140.11029817088449011No Hit
GTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCA304000.1088162651680567No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGG303130.10850485019866128No Hit
GCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCG302910.10842610158571071No Hit
GTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAAC295010.10559831048430397No Hit
GTGCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACG294530.10542649532877546No Hit
GCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAA294160.10529405447972223No Hit
GCGGGTGTTGACGCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGT292490.1046962809177793No Hit
GTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCA289510.10362959516053978No Hit
CTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAGACCCGACGCACC282460.1011060600637148No Hit
GGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAG280970.10057271718509504No Hit

[OK]Adapter Content

Adapter graph