FastQCFastQC Report
Tue 7 May 2024
EGAF00001703332

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00001703332
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5
Total Bases6.5 kbp
Sequences flagged as poor quality0
Sequence length1273-1319
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCGTAGGTGTGTGGATGTGAGCGGATACAATTTCACACAGGAATTCGGAT120.0No Hit
GCGCGGGATGTGTGTGGATGTGAGCGGATACAATTTCACACAGGAATTCG120.0No Hit
GAACTATGTTGGGGGGATGTGAGCGGATAACAATTTCACACAGGAATTCG120.0No Hit
CCTAGTGTGTGTATGTGAGCGGATACAATTTCACACAGGAATTCGGATCC120.0No Hit
GCCTAGTTGTGTGCATGTGAGCGGAAAACAATTTCACACAGGAATTCGGA120.0No Hit

[OK]Adapter Content

Adapter graph