FastQCFastQC Report
Tue 7 May 2024
EGAF00001703411

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00001703411
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5
Total Bases4.3 kbp
Sequences flagged as poor quality0
Sequence length189-1231
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGCTACTTGGCGGGTGGCGGTGTCGGGGCTGGCTTACTATGCGGCATCA120.0No Hit
ACCCAACCGTTGGGGGGGGAGGGGGGGGTGGTTTCATTCGGCCCAAAACA120.0No Hit
CGGCCTCCGGCCACGGGGTGGCGGGTGTCGGGGCTGGCTTAACTATGCGG120.0No Hit
TCCCCACAGTTTTTGGCGGGTGGGGGGGGGGGTTTACTATGCAGCATCAA120.0No Hit
CGGCTACGGATGCGGGTGGCGGGTGTCGGGGCTGGCTTACTATGCGGCAT120.0No Hit

[OK]Adapter Content

Adapter graph