FastQCFastQC Report
Fri 31 May 2024
EGAF00002300222

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300222
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2240057
Total Bases280 Mbp
Sequences flagged as poor quality0
Sequence length101-126
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAG69550.31048317074074455No Hit
GTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCC59560.265886091291427No Hit
GGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGG51250.22878882099875136No Hit
GTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGT50850.22700315215193187No Hit
GGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAG49970.22307468068892888No Hit
GGCAGAGGTTGTGCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAA47700.2129410099832281No Hit
GTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGT47530.2121821007233298No Hit
GTGCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGG46130.20593225975946144No Hit
GTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGTGCTGGCTGT42780.19097728316734797No Hit
GGTGTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACG41310.18441495015528622No Hit
GTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTC39540.17651336550810984No Hit
GTGCTGGCTGTAGAGGCAGAGGTTGTGCTGGTTGTAGGAGCAGAGGTTGT38850.17343308674734617No Hit
GTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAG36970.1650404431672944No Hit
CTTGGATACAGAAAGATGGCTTGTGCTGGTCTTTGAAACAGGGGTTGTGC33440.1492819155941121No Hit
CTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTCGG31750.14173746471629964No Hit
GTGGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCC31350.13995179586948012No Hit
GTTCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGG29550.13191628605879224No Hit
CCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGA28620.12776460598993686No Hit
CTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGT28280.12624678747014026No Hit
GGGAGAGATTGTGCTGGTTGTAGAAGCAGAGGTTGTGCTTGTGGTGGGAA28160.12571108681609441No Hit
GGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCT28020.12508610271970758No Hit
GTGCTGGTGGTGGGAACAGGGCTGGGAGTACTTCCAGGACCAGAGGTTGT27720.12374685108459293No Hit
AGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGAC27220.12151476502606853No Hit
GCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACC26410.117898785611259No Hit
GTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTG26150.11673810086082631No Hit
GTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGTGCTGGTTGT25780.11508635717751825No Hit
GGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGG25240.11267570423431189No Hit
GCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGTGC24620.10990791752174163No Hit
GTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGT24150.1078097566267287No Hit
AGAGGTTGTGCTGGTGGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAG24140.1077651149055582No Hit
GTGGGAACAGGGCTGGGAGTACTTCCAGGACCAGAGGTTGTGCTGGCTGT24090.10754190629970577No Hit
GTCCTTTTTAATTCTGTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCT23730.1059348043375682No Hit
GGTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGTGCTGGCTG23240.10374736000021427No Hit
GGGTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCAT23130.10325630106733891No Hit
GGTTGTGCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAACAGGGC22970.10254203352861109No Hit
GCTGGTTGTAGTAGCTGAGGTTGTGCTGCTTGTAGGGGCAGAGGTTGTGC22420.10008673886423426No Hit

[FAIL]Adapter Content

Adapter graph