FastQCFastQC Report
Fri 31 May 2024
EGAF00002300346

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300346
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4958994
Total Bases624.8 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCGGCC68850.13883864348293223No Hit
CTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGA61140.12329113525848187No Hit
GTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTG61090.1231903083568966No Hit
GGCAGAGGTTGTGCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAA56960.11486200628595235No Hit
GTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCT52490.10584808128422821No Hit
GTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAG50680.10219814744684103No Hit

[FAIL]Adapter Content

Adapter graph