FastQCFastQC Report
Fri 31 May 2024
EGAF00002300544

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300544
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1814608
Total Bases228.6 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTCGG86970.4792770670029009No Hit
GTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAG79800.43976440090642166No Hit
GGTGTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACG75650.41689444772645107No Hit
GGCACTTCTGTAGGGCTGGCATGAGTCAGTCAGTTCAAGACAACCTGAAG55790.30744932238808603No Hit
CCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGA49480.27267597189034765No Hit
CTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCAA48120.2651812402458272No Hit
GTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTC47630.26248093252096316No Hit
CTCCAATACATAAAAGGCACTTCTGTAGGGCTGGCATGAGTCAGTCAGTT42760.23564318023507005No Hit
GTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCT42650.23503698870499853No Hit
GTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCC42330.2332735224356996No Hit
GTCCTTTTTAATTCTGTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCT40260.22186610000617213No Hit
GTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTG39690.21872492571398341No Hit
GCCAACATGTTTTTCCTCCAATGCATAAAAGGAACTTCCATAGGGCTGGC37830.20847477802368336No Hit
GGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTT37710.20781347817269624No Hit
CTCCAGATGTCAACACAGAAGTAGCTGTTCACAATTGCTCAGTTACCTGG36950.2036252457831113No Hit
GGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCT36300.2000432049235978No Hit
GTGGGTTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCTTCTTTCCTTC32890.18125126749138107No Hit
CCCTTCTTTTCAATTTCTCCCACGTCAAGAGAAAAGCCAACATGTTTTTC30380.16741907894156755No Hit
GGGTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCAT28730.15832620599049493No Hit
ATCTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGG28600.15760979781859222No Hit
GGCAGAGGTTGTGCTGGTTGTAGGAGCAGAGGTTGTGCTGGTGGTGGGAA28500.1570587146094363No Hit
GTCTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGT28480.15694849796760513No Hit
CTCCAATGCATAAAAGGAACTTCCATAGGGCTGGCAGGAGTCAGGCTGTT27380.15088658266689003No Hit
CCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCA26460.1458166171426556No Hit
CTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAA26120.1439429342315255No Hit
CTTCTTTTCTTCCCCTTCCCCTTCTTTTCAATTTCTCCCACGTCAAGAGA25860.1425101178877201No Hit
CACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCAC25570.14091197658116794No Hit
GTCCTGCAAGACTTCAGGCTCTTTCTCATCCAGCAGCTCCCTGCTGAGCC25160.13865253542362868No Hit
CTTCTTTTCAATTTCTCCCACGTCAAGAGAAAAGCCAACATGTTTTTCCT24300.1339132198248878No Hit
CACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGAAC23220.1279615211660039No Hit
ACTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACG22550.12426926366465925No Hit
GTGGGAACAGGGCTGGGAGTAGTTCCAGGACCAGAGGTTGTGCTGGCTGT22460.12377328877641892No Hit
GAGGGTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATC22100.12178938922345763No Hit
GTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCACTGC21970.12107298105155495No Hit
GGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCAT21340.11760115683387266No Hit
CCCTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTC21320.11749094019204147No Hit
ATCCATGTCAACAGCCAAGCCAACACGCTGTTGCTCCAATACATAAAAGG20830.1147906324671775No Hit
GTCTTGGTCTTCTTCCACTTCTTGGTACTTTTCAATTTCATCCATGTCAA20420.11253119130963823No Hit
CTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGA19110.1053120012696957No Hit
CTCCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAG18990.10465070141870861No Hit
CCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCTGCTGAGGGTGG18660.10283212682849409No Hit

[WARN]Adapter Content

Adapter graph