FastQCFastQC Report
Fri 31 May 2024
EGAF00002300545

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300545
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1814608
Total Bases228.6 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCA69160.38112914745223214No Hit
CTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCT44820.24699549434368195No Hit
TCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTC43300.23861902956451203No Hit
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN39810.2193862255649705No Hit
CTCTGGTCCTGGAACTACTCCCAGCCCTGTTCCCACCACCAGCACAACCT35710.19679181398957793No Hit
CAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATAT35640.19640605574316877No Hit
CTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCC35590.1961305141385908No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN33060.18218810894694612No Hit
GTTGTCTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTAT30830.16989895338276917No Hit
GATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTC28880.1591528308042288No Hit
CAACCTCTGGTCCTGGAACTACTCCCAGCCCTGTTCCCACCACCAGCACA28570.15744447285584545No Hit
AGTAGAGCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCAACTC26660.14691878356096744No Hit
TGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCT25710.14168349307398623No Hit
ATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCT25220.13898318534912224No Hit
ATGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTCCTGCCAGC24570.13540114448960877No Hit
GGCTCAGCAGGGAGCTGCTGGAGGTAGTAGAGCCTGAAGTCTTGCAGGAC24300.1339132198248878No Hit
AATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGC24120.13292127004840715No Hit
CTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTATGCATT23650.13033117896537433No Hit
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN23480.12939433750980928No Hit
CTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTC23360.12873303765882216No Hit
GTTCCTTTTATGCATTGGAGGAAAAACATGTTGGCTTTTCTCTTGACGTG23040.12696957138952325No Hit
TATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGG23040.12696957138952325No Hit
GTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAAT22780.12553675504571787No Hit
TGTTATTCGACTCCTTCAGGTTATCTTGAACTGCCTGACTTAGGCCAGCC22440.12366307213458774No Hit
GCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCG22010.1212934143352173No Hit
TGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCT21640.1192544064613404No Hit
AGAAGATCAAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGA21450.11820734836394417No Hit
AGAAGATCAAAACCCACCATGCCCCAGGCTCAGCAGGGAGCTGCTGGATG20560.1133027078024565No Hit
CCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTCT20140.11098815832400166No Hit
GATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTC20100.1107677250403393No Hit
TGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTCCTGCCAGCC19810.10916958373378713No Hit
CTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTC19550.10773676738998175No Hit
GGAACTACTCCCAGCCCTGTTCCCACCACCAGCACAACCTCTGCTCCTAC19490.1074061174644882No Hit
CTGGATAGATGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTC19300.10635905936709196No Hit
GAAAGAGCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCGACTC19070.10509156798603335No Hit
ATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCA18660.10283212682849409No Hit
AGAGCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCAACTCCTT18460.10172996041018226No Hit
CCTGAAGATGCCCAAGATGAAAATGCCCAAGTTCAGCATGCCTGGCTTCA18440.10161974376835106No Hit

[WARN]Adapter Content

Adapter graph