FastQCFastQC Report
Fri 31 May 2024
EGAF00002300555

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300555
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1288847
Total Bases162.3 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN113000.8767526323915873No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN66720.5176719967536876No Hit
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN40950.31772584333128756No Hit
CAAAGATCCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGATC31100.24130094572901206No Hit
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN25410.19715295919531176No Hit
TGTTATTCGACTCCTTCAGGTTATCTTGAACTGCCTGACTTAGGCCAGCC22890.1776005996056941No Hit
GTTATCTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTAC22460.17426428427889423No Hit
CTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCT20480.1589017160299089No Hit
CCCCAGGCTCAGCAGGGAGCTGCTGGATGAGAAAGGGCCTGAAGTCTTGC20480.1589017160299089No Hit
AGAAGATCAAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGA17700.13733204949850525No Hit
TGCAGATCTTCGTGAAGACCCTGACTGGTAAGACCATCACTCTCGAAGTG17630.13678892839879364No Hit
GCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCA17520.13593545238496113No Hit
AGAAGATCAAAACCCACCATGCCCCAGGCTCAGCAGGGAGCTGCTGGATG17430.13523715382818907No Hit
GGGGAAGAAAAGAAGGGGAAGAAGATCAAAACCCACCATGCCCCAGGCTC16990.131823249772859No Hit
GCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCAACTCCTTCCA16830.13058183011637534No Hit
TGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTCCTGCCAGCC16690.12949558791695212No Hit
GTTGTCTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTAT16630.12903005554577074No Hit
TGTTATTCAACTCCTTCAGGTTGTCTTGAACTGACTGACTCATGCCAGCC16400.1272455147895755No Hit
CAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATAT16380.12709033733251504No Hit
CTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCC16280.12631445004721273No Hit
ATCCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGATCTTTGC15990.12406437691983611No Hit
TCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTC15870.12313331217747335No Hit
CTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTC15360.11917628702243167No Hit
CTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTC15260.11840039973712939No Hit
GTCTTGCAGGACTCACTGGATAGATGTTATTCAACTCCTTCCAGTTGTCT15180.11777968990888757No Hit
CTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTACTCATT15170.11770210118035732No Hit
GGTTGATCTTTGCTGGGAAACAGCTGGAAGATGGACGCACCCTGTCTGAC14630.11351230983972496No Hit
CTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTATGCATT14630.11351230983972496No Hit
CCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGATCTTTGCTG14460.11219330145471108No Hit
CATCCCTCCTGACCAGCAGAGGTTGATCTTTGCTGGGAAACAGCTGGAAG13420.10412407368756726No Hit
GGCAAAGATCCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGA12900.10008945980399535No Hit

[FAIL]Adapter Content

Adapter graph