FastQCFastQC Report
Fri 31 May 2024
EGAF00002300573

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300573
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3651900
Total Bases460.1 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC53

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCT65890.1804266272351379No Hit
CTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTATGCATT64420.17640132533749556No Hit
TGTTATTCGACTCCTTCAGGTTATCTTGAACTGCCTGACTTAGGCCAGCC58030.15890358443549932No Hit
GCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCA56820.1555902406966237No Hit
GTTATCTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTAC54420.1490183192310852No Hit
TGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTCCTGCCAGCC48700.13335523973821847No Hit
GTTGTCTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTAT48170.1319039404145787No Hit
GGTTGATCTTTGCTGGGAAACAGCTGGAAGATGGACGCACCCTGTCTGAC47200.1292477888222569No Hit
CCACAGGTGACACCACCCCTCTTCCTGTCACCGACACTTCCTCAGCATCC42660.1168159040499466No Hit
CCACAGGTCACGCCACCCCTCTTCCTGTCACCGACACTTCCTCAGCATCC38220.1046578493387004No Hit
CTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTACTCATT38140.10443878528984911No Hit
AGTAGAGCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCAACTC37140.10170048467920809No Hit
CCGACACTTCCTCAGCATCCACAGGTCACGCCACCCCTCTTCCTGTCACC36920.10109805854486706No Hit

[WARN]Adapter Content

Adapter graph