FastQCFastQC Report
Fri 31 May 2024
EGAF00002300652

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002300652
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5091089
Total Bases641.4 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCAA391530.7690496080504584No Hit
GTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAG386960.7600731395581574No Hit
CTCCAATACATAAAAGGCACTTCTGTAGGGCTGGCATGAGTCAGTCAGTT355130.6975521347200963No Hit
CTTCTTTTCAATTTCTCCCACGTCAAGAGAAAAGCCAACATGTTTTTCCT300040.5893434587374136No Hit
GTCCTTTTTAATTCTGTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCT297460.584275780682679No Hit
CCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGA295150.5797384410290215No Hit
CTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCAATTT259750.5102051839989441No Hit
CTTCTTTTCTTCCCCTTCCCCTTCTTTTCAATTTCTCCCACGTCAAGAGA237700.466894214577667No Hit
CTCCAATGCATAAAAGGAACTTCCATAGGGCTGGCAGGAGTCAGGCTGTT200410.3936485887400515No Hit
CACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCAC156540.30747841964656286No Hit
CCAGTGAGTCCTGCAAGACTTCAGGCTCTTTCTCATCCAGCAGCTCCCTG123860.24328783095325968No Hit
CTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCC117530.23085434177245773No Hit
CCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCAATTTCTCCCACGTCAAGA117040.22989187578531822No Hit
CCCTGCTGAGCCTGGGGCATGATGGGTCTTGGTCTTCTTCCACTTCTTGG116030.22790801732203073No Hit
CTCCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAG108120.21237106638677894No Hit
GTCCTGCAAGACTTCAGGCTCTTTCTCATCCAGCAGCTCCCTGCTGAGCC106950.21007293331544588No Hit
CTTTTTAATTCTGTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCA106870.2099157960114231No Hit
GTACTTTTCAATTTCATCCATGTCAACAGCCAAGCCAACACGCTGTTGCT106530.2092479624693263No Hit
GTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGAACTTC106080.2083640651341982No Hit
GTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCACTGC106030.20826585431918399No Hit
GGCACTTCTGTAGGGCTGGCATGAGTCAGTCAGTTCAAGACAACCTGAAG102420.2011750334751563No Hit
CACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGAAC102380.20109646482314492No Hit
CCCTTCTTTTCAATTTCTCCCACGTCAAGAGAAAAGCCAACATGTTTTTC101300.19897511121883746No Hit
GTGGGTTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCTTCTTTCCTTC95980.188525480501323No Hit
CCCTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTC92100.18090432125621847No Hit
GTCTTGGTCTTCTTCCACTTCTTGGTACTTTTCAATTTCATCCATGTCAA89940.17666161404760355No Hit
CTGGGGCATGATGGGTCTTGGTCTTCTTCCACTTCTTGGTACTTTTCAAT86600.17010113160465276No Hit
CTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTCGG84390.16576021358102364No Hit
ATCCATGTCAACAGCCAAGCCAACACGCTGTTGCTCCAATACATAAAAGG83960.16491560057190122No Hit
TTCTTTTCTTCCCCTTCCCCTTCTTTTCAATTTCTCCCACGTCAAGAGAA81650.16037826091824361No Hit
CTTCTTTTCTTCCCCTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTT81220.15953364790912122No Hit
CCAGTGAGTCCTGCAAGACTTCAGGCCCTTTCTCATCCAGCAGCTCCCTG80520.15815869649892195No Hit
CGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGAACTT75810.14890723772458114No Hit
CCCCTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTT72380.1421699758146047No Hit
CTCGGCTCCACTTCGAGAGTGATGGTCTTACCAGTCAGGGTCTTCACGAA69890.13727907722689586No Hit
TCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGC68950.13543271390462827No Hit
GCTGGCAGGAGTCAGGCTGTTCAAGACAACTGGAAGGAGTTGAATAACAT66340.13030610936088524No Hit
CCAGTGAGTCCTGCAAGACTTCAGGCTCTACTACCTCCAGCAGCTCCCTG65590.12883294713567175No Hit
CGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCACTG62040.12185997926966116No Hit
CCCTGCTGAGCCTGGGGCATGGTGGGCCTTGGTCTTCTTCCTCTTCTTGG61070.11995468945838503No Hit
CCAATACATAAAAGGCACTTCTGTAGGGCTGGCATGAGTCAGTCAGTTCA58070.11406204055753101No Hit
GGCTGGCCTAAGTCAGGCAGTTCAAGATAACCTGAAGGAGTCGAATAACA56830.111626412345178No Hit
GGCAGGAGTCAGGCTGTTCAAGACAACTGGAAGGAGTTGAATAACATCTA56170.11033002958699012No Hit
GTGGACTCTTTCTGGATGTTGTAGTCAGACAGGGTGCGTCCATCTTCCAG55350.1087193722207567No Hit
CCTTCTTCTTTCCTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCC55120.10826760247169122No Hit
CCAACATGTTTTTCCTCCAATGCATAAAAGGAACTTCCATAGGGCTGGCA54190.10644088131242647No Hit
CCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCA52510.10314099792794822No Hit
CTTGGTCTTCTTCCACTTCTTGGTACTTTTCAATTTCATCCATGTCAACA51800.1017464043547461No Hit

[FAIL]Adapter Content

Adapter graph