FastQCFastQC Report
Thu 9 May 2024
EGAF00002481595

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002481595
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences38157998
Total Bases2.7 Gbp
Sequences flagged as poor quality0
Sequence length35-76
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN26378586.912988464436736No Hit
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT20388885.343278229638777TruSeq Adapter, Index 15 (97% over 40bp)
AGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG9082732.380295213601091No Hit
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG8120512.1281278960180248No Hit
AATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT1926540.5048849785043754TruSeq Adapter, Index 15 (97% over 40bp)
TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG617380.1617957000783951No Hit
AGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCT485080.12712406976906912TruSeq Adapter, Index 15 (96% over 33bp)
AAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTC484430.12695372540247002TruSeq Adapter, Index 15 (97% over 34bp)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCGCGTAT418080.10956549659654576TruSeq Adapter, Index 15 (97% over 40bp)

[WARN]Adapter Content

Adapter graph