FastQCFastQC Report
Wed 1 May 2024
EGAF00002481604

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00002481604
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35115607
Total Bases2.5 Gbp
Sequences flagged as poor quality0
Sequence length35-76
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN22704156.465543938910126No Hit
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC10273012.9254826778304017TruSeq Adapter, Index 4 (100% over 50bp)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATATCGTATGC550030.15663405732955152TruSeq Adapter, Index 4 (98% over 50bp)

[OK]Adapter Content

Adapter graph