FastQCFastQC Report
Fri 31 May 2024
EGAF00003249718

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00003249718
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3409316
Total Bases429.5 Mbp
Sequences flagged as poor quality0
Sequence length126
%GC54

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTCGG254020.7450761384394993No Hit
GTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTG163860.48062426598179814No Hit
GTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCT124920.3664078073138424No Hit
CTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAA105640.30985687451676525No Hit
GGTGTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACG91210.26753166910899434No Hit
GGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCT78110.22910753945952797No Hit
GTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAG76060.22309460314033666No Hit
GTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCC71130.20863422457759856No Hit
GTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCCGCAGACGCTC67780.19880820669013963No Hit
GGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTT67000.196520357749179No Hit
CCCACGTCAAGAGAAAAGCCAACATGTTTTTCCTCCAATGCATAAAAGGA64890.19033143304991382No Hit
CTTCTTTGATCTTCTTCCCCTTCTTTTCTTCCCCTTCCCCTTCTTTTCAA58000.17012210073809525No Hit
CTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGA54680.16038407704067326No Hit
CTCGGAAGGTGTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGCCCCC54200.15897617000008213No Hit
TGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCG53370.15654166407572662No Hit
GTGGATTCTTCACTGACGCCTGAGCTTGTCGTGCTGGCAGGTGAGAGTGT51660.1515259952436207No Hit
GGGTGGAAGCGGCCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCAT47110.13818020975468392No Hit
GTGCGTTGAGCCTGGTCGGCTGTGGGAGGTGGTGGATTCTTCACTGACGC44310.12996741868456899No Hit
CTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGT42100.12348518001851398No Hit
CTTCTTTTCAATTTCTCCCACGTCAAGAGAAAAGCCAACATGTTTTTCCT41090.1205227089539368No Hit
GGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCGC40320.11826419140965519No Hit
GTCTTCACGAAGATCTGCATCCCACCTCTAAGACGGAGCACCAGGTGCAG38150.11189927833031611No Hit
AGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCGCTGA37890.11113666201666259No Hit
GGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCGCTGAG37730.11066735966979886No Hit
CTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTA37230.10920078983584977No Hit
TGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAG37130.10890747586905995No Hit
CTCGGCTCCACCTCGAGAGTGATGGTCTTACCAGTCAGGGTCTTCACGAA35500.1041264582103859No Hit
CCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCTGCTGAGGGTGG35450.10397980122699099No Hit
GCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAAGG35260.10342250469009033No Hit

[FAIL]Adapter Content

Adapter graph