FastQCFastQC Report
Wed 8 May 2024
EGAF00003948249

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00003948249
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences561742
Total Bases35.3 Mbp
Sequences flagged as poor quality0
Sequence length63
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[OK]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAGGA21110.37579529392496913No Hit
GTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAG16260.28945672568545705No Hit
CTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAA7630.13582747951906746No Hit
TTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAA6050.10770068821629858No Hit
TGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAGG6040.10752267054982537No Hit
ACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAGGAAGA5710.10164808755620909No Hit

[OK]Adapter Content

Adapter graph