FastQCFastQC Report
Wed 8 May 2024
EGAF00003948250

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00003948250
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences574192
Total Bases36.1 Mbp
Sequences flagged as poor quality0
Sequence length63
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[OK]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGAGAAAACGCTACCTCTCTTCCTCGTGGTTTTCGGTGCTCTACAC26930.4690068827151893No Hit
TCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGATCATCAATGGCT21030.3662537966394516No Hit
GTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGATCATCAATGG9330.1624892022180734No Hit
CGCTACCTCTCTTCCTCGTGGTTTTCGGTGCTCTACACGTTCAGAGAAAC8410.14646668710117872No Hit
TCAGGAGAAAACGCTACCTCTCTTCCTCGTGGTTTTCGGTGCTCTACACG7720.13444980076350768No Hit
TTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGATCATCAATGGC7340.12783180538913813No Hit
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG6980.12156212556078802No Hit

[OK]Adapter Content

Adapter graph