FastQCFastQC Report
Wed 8 May 2024
EGAF00003948251

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00003948251
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences574192
Total Bases36.1 Mbp
Sequences flagged as poor quality0
Sequence length63
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[OK]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAGGA22550.3927257781369298No Hit
GTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCACGAG15830.27569175467439466No Hit
CTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAA7540.1313149608493326No Hit
TTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAA6030.10501713712486416No Hit

[OK]Adapter Content

Adapter graph