FastQCFastQC Report
Wed 8 May 2024
EGAF00004043496

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004043496
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14541572
Total Bases741.6 Mbp
Sequences flagged as poor quality0
Sequence length51
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTA10305927.087211753997435TruSeq Adapter, Index 27 (97% over 44bp)
GAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGT1228290.8446748398316221TruSeq Adapter, Index 27 (97% over 39bp)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTAT935080.6430391432233049TruSeq Adapter, Index 27 (97% over 44bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTAACTCGTA727670.5004066960573451TruSeq Adapter, Index 27 (97% over 41bp)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT690890.4751136947229639Illumina Single End PCR Primer 1 (100% over 50bp)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATG547400.3764379807080005TruSeq Adapter, Index 27 (97% over 43bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTACCTCGTA464380.31934649156226025TruSeq Adapter, Index 27 (97% over 41bp)
GGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCG361660.24870763628581558TruSeq Adapter, Index 27 (97% over 40bp)
CGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCC258480.17775244657180117TruSeq Adapter, Index 27 (97% over 41bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTAGCTCGTA208180.14316196350710914TruSeq Adapter, Index 27 (97% over 41bp)
AATGATACGGCGACCACCGAGATCGGAAGAGCACACGTCTGAACTCCAGT158510.10900472108517567Illumina Multiplexing PCR Primer 2.01 (100% over 31bp)

[WARN]Adapter Content

Adapter graph