FastQCFastQC Report
Sat 25 May 2024
EGAF00004150087

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004150087
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences130625904
Total Bases9.7 Gbp
Sequences flagged as poor quality0
Sequence length75
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[OK]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGTACAGCATCTCGTA15995441.2245228174650564Illumina Paired End Sequencing Primer 2 (100% over 36bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAG2941050.2251505949386578Illumina Paired End PCR Primer 2 (97% over 36bp)
CTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGT2186390.16737798040425425No Hit

[OK]Adapter Content

Adapter graph