FastQCFastQC Report
Wed 8 May 2024
EGAF00004953452

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953452
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences138919
Total Bases29.7 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC49

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC14351.0329760507921881No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA12240.8810889799091557No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT11800.8494158466444475No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA11640.8378983436390991No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT9980.718404249958609No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA8470.6097078153456331No Hit
GGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGG8260.5945910926511132No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT8230.5924315608376104No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG8230.5924315608376104No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA8160.5873926532727705No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT8060.5801942138944277No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA8000.575875150267422No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT7970.5737156184539193No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC7790.5607584275729022No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC7490.5391631094378738No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA7480.5384432655000395No Hit
GGGAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCTC7130.51324872767584No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA6870.4945327852921486No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT6540.4707779353436175No Hit
GGGAGACATCTGTGTACTTCTGTGCCAGCAGGGGGACAGCCTCGAACACT6480.4664588717166118No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA6200.4463032414572521No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT6150.44270402176808066No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT6100.43910480207890923No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT6080.4376651142032407No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA6020.43334605057623504No Hit
GGGGCATTACTCATATGGTGTTCACGACACTAACAAAGGAGAAGTCTCAG5550.399513385498024No Hit
GGGAGTAGAGTCTGGAGAGTTTAGAATGATGGTTTTTGCAATGACTTAGA5470.39375463399534977No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA5330.3836768188656699No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT5200.37431884767382434No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA5190.37359900373599003No Hit
GGGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTAT5140.36999978404681866No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG5000.3599219689171388No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA4970.3577624371036359No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA4770.3433655583469504No Hit
GGGATGCTCACAGAGGGCCTGGTCTAGAATATTCCACATCTGCTCTCACT4760.3426457144091161No Hit
GGGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGC4730.3404861825956133No Hit
GGGAGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGC4720.339766338657779No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG4690.3376068068442762No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG4680.3368869629064419No Hit
GGGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTC4640.33400758715510476No Hit
GGGGATTCTGAACTGAACATGAGCTCCTTGGAGCTGGGGGACTCAGCCCT4630.3332877432172705No Hit
GGGAGACACAGAGTCTGAGTTCTGGGGCCTGGAACCTCAATGTGCACTTG4620.3325678992794362No Hit
GGGGGGTGAGACCAACTGCATTTTGGCCATGGCTTTGCAGAGCACTCTGG4600.33112821140376764No Hit
GGGGCATGTTCACAGAGGGCCTGGTCTGGAATATTCCACATCTGCTCTCA4590.3304083674659334No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC4520.32536945990109345No Hit
GGGGATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAG4500.3239297720254249No Hit
GGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTT4430.31889086446058496No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC4420.3181710205227507No Hit
GGGAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCT4360.31385195689574497No Hit
GGGACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCT4330.31169242508224215No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT4330.31169242508224215No Hit
GGGGATAGTCACCGTGAACACCAATGCAGGCAAATCAACCTTTGGGGATG4300.30953289326873934No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT4290.30881304933090503No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC4260.3066535175174022No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG4150.29873523420122516No Hit
GGGAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGGG4100.2951360145120538No Hit
GGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT4060.29225663876071667No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC4040.2908169508850481No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG4020.28937726300937955No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA4010.2886574190715453No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN3920.2821788236310368No Hit
GGGCTGGTGACCCCAAAGCAAGGAGGACCTAGTAACATAATTGTGCTTCA3920.2821788236310368No Hit
GGGAAACATTAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGAC3820.274980384252694No Hit
GGGATGGCTGGAGATTGCAGGTTTATGACTGATCCTATTTGGGAAGAACA3780.2721010085013569No Hit
GGGAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTGTCAG3760.2706613206256884No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC3750.2699414766878541No Hit
GGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAG3680.26490256912301413No Hit
GGGGAAACATTGTTGAACAAGTGGAACTGCCCTGCAGTGGAAAGGCTGCT3490.2512255343041629No Hit
GGGGAAGCACAGAGGAGAACCCATCAGAGCAGGAGACTTTTCACTCTGCA3440.2476263146149915No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG3430.24690647067715718No Hit
GGGGAAAGAAGGAAGATTCACAATCTCCTTCAATAAAAGTGCCAAGCAGT3400.2447469388636544No Hit
GGGAGTCTTGCTCCTCACAGAGCTTTGAGGAGCTGGATCAAAATTGTGCT3380.2433072509879858No Hit
GGGAGAAGCCTCACACAGCCCAGTAACTTTGCTAGTACCTCTTGAGTGCA3380.2433072509879858No Hit
GGGAGAGCTGCTCCTATGCTGTGAGTGGTCTGATTTTCTCAGCATCTCTG3320.23898818736098013No Hit
GGGGAGTTACCAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTCATAC3240.2332294358583059No Hit
GGGACAATGAGCAGTTCTTGGGGCCAGGGACACGGCTCACCGTGCTAGAG3200.2303500601069688No Hit
GGGGATGCTCATGCTCACAGAGGGCCTGGTCTAGAATATTCCACATCTGC3200.2303500601069688No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC3180.22891037223130026No Hit
GGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGATT3150.22675084041779742No Hit
GGGGATATTCCGAAATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCA3150.22675084041779742No Hit
GGGAGAAAGAAAAAAGGAAAGAAAGACTGAAGGTCACCTTTGATACCACC3140.22603099647996316No Hit
GGGGAGGCCCCATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTCT3090.2224317767907918No Hit
GGGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATT3080.22171193285295746No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT3060.22027224497728892No Hit
GGGATAGCATCTGAGGACTGACTGTCTAGCTTAGACTGCTGTCTGCACAA3020.21739286922595183No Hit
GGGCAGTGCCAACCCATAGGGCGGATACAAAAGACAGGCAAGGAAGGGGT2990.215233337412449No Hit
GGGAGAGCAGGAGACTTTTCACTCTGCAGGGGAGCGCTGTCAGCATGACA2980.2145134934746147No Hit
GGGTGGGGGACCCAGGGCCTCTGCTTTGGGGAAAGACCTTGCTGAGGGCC2980.2145134934746147No Hit
GGGGGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCAGACT2970.2137936495367804No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA2960.21307380559894615No Hit
GGGAGGAATAAGTGCCTTACACTGGCTGCAACAGCATCCAGGAGGAGGCA2940.21163411772327761No Hit
GGGGGCGGTGTGGCTAGGGCTTCTCCTCAACTCTCTCTGGAAGGTTGCAG2940.21163411772327761No Hit
GGGAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAA2920.21019442984760903No Hit
GGGAGAAAGTCCAGCACCTTGATCCTGCCCCACGCTACGCTGAGAGACAC2900.2087547419719405No Hit
GGGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTA2890.20803489803410619No Hit
GGGAGAAACCATCTGCCCTTGTGAGCGACTCCGCTTTGTACTTCTGTGCT2890.20803489803410619No Hit
GGGAGGGTTTCCCAGGATGTTGCCCAATACCATGGGGCAATTGGTAGAGG2880.20731505409627193No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC2840.2044356783449348No Hit
GGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAACA2830.20371583440710056No Hit
GGGAGAGACTCCCAGCCCAGTGATTCAGCCACCTACCTCTGTGCCGCTGG2820.20299599046926628No Hit
GGGGGAACTGTTTATTGCGCATACAGTTAGAGAGAAAGAAAAATGTATCA2790.20083645865576344No Hit
GGGGACTGTTCCCCTATCACCGATGCACAGACCCAGAAGACCCCTCCATC2790.20083645865576344No Hit
GGGGGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCACAGGAG2770.19939677078009485No Hit
GGGAGACTGCTGTCTGCACAAGAAGAAGACTTACAGATGCTTAAGGAGGA2750.19795708290442632No Hit
GGGGGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCT2750.19795708290442632No Hit
GGGATTCAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTT2720.19579755109092348No Hit
GGGAAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTC2700.19435786321525494No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG2690.19363801927742064No Hit
GGGATGTTTAGATACGATGCTAGATGCATGACATGTAGAATTGTTCATCT2680.19291817533958638No Hit
GGGAGGTGTAACCTCTGGCTGTCTCTTCTGCCTGGTTTTTGTTGAGCTTC2640.19003879958824926No Hit
GGGGGTTTCAGCTGGTTGGGAAGACTGGAAGACCACCTGGGCTGTCATTG2640.19003879958824926No Hit
GGGAGAACACATCCAGGCTCCTTAAGGGAAAGCCTCTTTCTGTCTTTGAA2630.18931895565041498No Hit
GGGATTTTTTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGT2620.1885991117125807No Hit
GGGGCTCATTTTCTCTTGCCGCCACCATGTAAGATGTGCCTTTTGCTTCC2610.18787926777474642No Hit
GGGGACCTGAACAAGGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATC2600.18715942383691217No Hit
GGGGAGGCTTTGTCGGGTGGAGCTGATTGGTTGCAGGAGCAGCAACAGTT2570.18499989202340933No Hit
GGGGGTAAAGCTGCTGACAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCT2570.18499989202340933No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGGTCCTACATTCCTGATA2550.18356020414774077No Hit
GGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCGCCTGGTTCT2540.1828403602099065No Hit
GGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAA2540.1828403602099065No Hit
GGGGGGTTTTTGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTT2520.18140067233423796No Hit
GGGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA2510.18068082839640365No Hit
GGGGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCAC2500.1799609844585694No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT2490.1792411405207351No Hit
GGGGGTTTTTTGCCCAATGCCCTCCACAAAGCCAGCGTTTGAAGGAAAAC2490.1792411405207351No Hit
GGGGATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTCTTCTGTGATTT2490.1792411405207351No Hit
GGGGAGAAGCCTCACACAGCCCAGTAACTTTGCTAGTACCTCTTGAGTGC2480.17852129658290083No Hit
GGGGATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAAC2470.17780145264506655No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC2460.17708160870723227No Hit
GGGAGAAGAGGCCTTCCTGACTATAAACTGCACGTACACAGCCACAGGAT2460.17708160870723227No Hit
GGGGGTCTCTGAAGGAACCCCGGTGCTGCTGAGGTGCAACTACTCATCTT2450.176361764769398No Hit
GGGTGAAGTTTCAGATTGATTGAAGTTAAAATTAGGGGTGACACTATGTC2440.1756419208315637No Hit
GGGAGACTCCCAGCCATCAGGTCACACAGATGGGACAGGAAGTGATCTTG2430.17492207689372943No Hit
GGGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTT2430.17492207689372943No Hit
GGGTACAAAAGACAGGCAAGGAAGGGGTAGAACCATCAAAGAGGAATAGG2430.17492207689372943No Hit
GGGAGCATGGGCTGCAGGCTGCTCTGCTGTGCGGTTCTCTGTCTCCTGGG2410.17348238901806087No Hit
GGGGACTTTCTAGCCTGCTGAAGGTGGTCACAGCTTCACTGTGGCTAGGA2410.17348238901806087No Hit
GGGGAATAATCTTGTGGATGCAGCTGACATGGGTCAGTGGTCAACAGCTG2400.17276254508022662No Hit
GGGATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTCATCCGTATAT2400.17276254508022662No Hit
GGGATAGGACTGTGTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTTG2400.17276254508022662No Hit
GGGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCA2400.17276254508022662No Hit
GGGGAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTGCTGTGAGTGCT2380.17132285720455806No Hit
GGGGACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCA2370.17060301326672378No Hit
GGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG2360.1698831693288895No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG2360.1698831693288895No Hit
GGGACCTTTGGCAAAGGGACTCATCTAATCATCCAGCCCTATATCCAGAA2360.1698831693288895No Hit
GGGAAGAAGAGTGAAACCTCCTTCCACCTGACGAAACCCTCAGCCCATAT2360.1698831693288895No Hit
GGGGACATCACTGCAGCCCAGCCTGGTGATACAGGCCTCTACCTCTGTGC2340.16844348145322094No Hit
GGGATATAAGATTTCACATCTCTGTTGCTTATTCAGTCAAGTCAGAGAGA2340.16844348145322094No Hit
GGGGGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCCATGG2330.16772363751538666No Hit
GGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTG2310.1662839496397181No Hit
GGGAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCTGCCGTCACGG2300.16556410570188382No Hit
GGGAGTATCACTGTGTCTTATAACACCGACAAGCTCATCTTTGGGACTGG2290.16484426176404957No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT2250.16196488601271244No Hit
GGGGGATCATCACAGAAGACAGAAAGTCCAGCACCTTGATCCTGCCCCAC2220.1598053541992096No Hit
GGGGACTATGACAAAGATTTTAACAATGAAGCAGACACCCCTGATAACTT2220.1598053541992096No Hit
GGGGGAGCCCAGAAGCTGGTATTTGGCCAAGGAACCAGGCTGACTATCAA2210.15908551026137535No Hit
GGGAGTAACTTTGCTAGTACCTCTTGAGTGCAAGGTGGAGAATTAAGATC2200.15836566632354104No Hit
GGGAGCACAGCACCAACAGGGGCTTTTGGTAAAGGGCCTGGGCACTATGT2200.15836566632354104No Hit
GGGGGTGAAACCCAGTAAGTATAAAATTGTATCCCTGGATTAAGCAATGT2190.1576458223857068No Hit
GGGGGAGAAGAAAAGCAGCGGAGACAAGCTGACTTTTGGGACCGGGACTC2160.15548629057220395No Hit
GGGACATCTGTCTCTGCGCATTGCAGACACCCAGACTGGGGACTCAGCTA2150.15476644663436967No Hit
GGGGAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGA2130.1533267587587011No Hit
GGGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGCA2120.15260691482086683No Hit
GGGAGTGGTGAATTAGGGGTGTTAAAAAGAGCATCATTTTTTTGAACTGG2110.15188707088303258No Hit
GGGGATTACATACATTGGTATCGACAGCTTCCCTCCCAGGGTCCAGAGTA2100.15116722694519827No Hit
GGGATTGTGCCTTCGTCCCCCTGCCTTCTAAGAAACCAGTGGCTCTAGGT2090.15044738300736402No Hit
GGGGACAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCTGACTTTTGGGAC2090.15044738300736402No Hit
GGGGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGC2090.15044738300736402No Hit
GGGGACAATAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGT2090.15044738300736402No Hit
GGGGATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCAGTAATAATGG2080.14972753906952974No Hit
GGGATTGTTCATCCGTATATCCAGAACCCTGACCCTGCCGTGTACCAGCT2080.14972753906952974No Hit
GGGGAGCCCCAAGCTAGGAGATCCTGCCATGGGCTTCAGGCTCCTCTGCT2080.14972753906952974No Hit
GGGGGGGAAAAATTGCAGTTTGGAGCAGGGACCCAGGTTGTGGTCACCCC2070.14900769513169546No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT2060.14828785119386118No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT2060.14828785119386118No Hit
GGGGATTTGCAGCTTTCTAGGCAGGAGACTCTGCAGTGTACTTCTGTGCA2050.1475680072560269No Hit
GGGGACTCTTCTTTGGAAAGGGAACACAACTCATCGTGGAACCAGGAAGT2030.14612831938035833No Hit
GGGGGTAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTC2030.14612831938035833No Hit
GGGGGGGGACTGTTTATTGCGCATACAGTTAGAGAGAAAGAAAAATGTAT2020.14540847544252405No Hit
GGGGGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGG2010.14468863150468977No Hit
GGGGGCTACGCTGAGAGACACTGCTGTGTACTATTGCATCGTCAGAGGGA2000.1439687875668555No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT1990.1432489436290212No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACGGACCCGCAGCCCCTCAAGGA1980.14252909969118696No Hit
GGGGAACATTTCACTCAGGGGAAGAGCTATGAACATGCTGACTGCCAGCC1980.14252909969118696No Hit
GGGGAAGGTTTTTCGTAATGATGCCTGTGGTAGTGCTTTGACAGCACAAC1970.14180925575335265No Hit
GGGGAGTTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGC1970.14180925575335265No Hit
GGGAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGTG1970.14180925575335265No Hit
GGGGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATAACCAG1940.13964972393984984No Hit
GGGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCA1940.13964972393984984No Hit
GGGGGAGAGTCCTGCTCCCCTTTCATCAATGCACAGATACAGAAGACCCC1930.13892988000201556No Hit
GGGGGCTGTTGCTCACAGTGACCCTGATTGGGCAAAGCTCCCATCCTTCC1930.13892988000201556No Hit
GGGAAAGAGAAGATGTTGAATACACAAGTCAACTTCTGGGAGCAGATCTC1920.13821003606418128No Hit
GGGAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCT1890.13605050425067844No Hit
GGGGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTG1880.1353306603128442No Hit
GGGGGGGGCCCCAAGAGTTCTGTGTGTAAGCAGCTTCTGGAAGGAAGGGC1860.13389097243717563No Hit
GGGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGA1840.13245128456150707No Hit
GGGATCTCTGGGGTTTTTGCAAAGAAAGGAAACTCTGTGCATACTCTGGG1820.1310115966858385No Hit
GGGGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCC1820.1310115966858385No Hit
GGGGGTCATGGGCAGCTGCCCCCAGCTGGCAGAGGGCAGGATTTTGTACT1810.13029175274800422No Hit
GGGGATCACTGTGTGAATAATAATGCAGGCAACATGCTCACCTTTGGAGG1810.13029175274800422No Hit
GGGGAGACAAGACAATCTGCATCTTCACAGGAGGGATGGCCATGCTCCTG1800.12957190881016997No Hit
GGGAGTGTTTCTTCTGGTTCTGCAAGGCAACTGACCTTTGGATCTGGGAC1790.12885206487233566No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA1780.1281322209345014No Hit
GGGAGAATGACTTCCTTGAGAGTCCTGTTCCCCTTTCATCAATGCACAGA1780.1281322209345014No Hit
GGGGGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCTCCGAGAGGG1780.1281322209345014No Hit
GGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTC1780.1281322209345014No Hit
GGGGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGGCTGC1780.1281322209345014No Hit
GGGGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA1780.1281322209345014No Hit
GGGATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACC1770.12741237699666713No Hit
GGGGGATTCTGTGATCAGTCATCCCTCCTCGCTGGTGAATGGAGGCAGTG1760.12669253305883285No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT1760.12669253305883285No Hit
GGGGAATATGAAGGCTGCAGCGATGCCTGCAAGTCAGCTTTTGCTACACT1760.12669253305883285No Hit
GGGAAATTAACCTTTGGGACTGGAACAAGACTCACCATCATACCCAATAT1750.12597268912099857No Hit
GGGGAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCA1730.12453300124533001No Hit
GGGGGAGATATAGCATCTGAGGACTGACTGTCTAGCTTAGACTGCTGTCT1710.12309331336966145No Hit
GGGAGACTGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCA1710.12309331336966145No Hit
GGGAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGAATATGA1700.1223734694318272No Hit
GGGAGGTGCAGTGCTGCCTGCCCCACTGTGCCATGGGCCCTGGGCTCCTC1700.1223734694318272No Hit
GGGGGAAAACACACTTGATAACTGAAGGATGATGAAGTGTCCACAGGCTT1700.1223734694318272No Hit
GGGGCACTCTGCAGGGGAGCGCTGTCAGCATGACACGTGTTAGCTTGCTG1690.1216536254939929No Hit
GGGGGGGGCAGGGCCAGGGTAGTGATGGGGGCTGTGGCTTCTCTATAAGG1680.12093378155615861No Hit
GGGACAGTGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCC1670.12021393761832434No Hit
GGGAAAAATGATGCTGTAAAATGGAAATGAGACCTTTAGAAAGAGAGATG1670.12021393761832434No Hit
GGGGGCTGTGAGTGCTCAGGGCGGATCTGAAAAGCTGGTCTTTGGAAAGG1660.11949409368049006No Hit
GGGAAAAGGAACTGGAAACAGAGGCTGCAAGGTGGGGAGACTTCCACTAG1660.11949409368049006No Hit
GGGAGGCAGCACAGTGCTGTGATTTATAGCACATTCATCTTTGGGAGTGG1660.11949409368049006No Hit
GGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTGA1650.1187742497426558No Hit
GGGGGTACAAAGCTGTAACATTGTGGGGACGGAACAAGAGACCCAGTACT1650.1187742497426558No Hit
GGGGCCATTTCAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAG1640.1180544058048215No Hit
GGGACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTTT1640.1180544058048215No Hit
GGGGGCAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCC1630.11733456186698724No Hit
GGGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTG1630.11733456186698724No Hit
GGGAAACAGAATGGCTTTTTGGCTGAGAAGCCTGGGTCTACATTTCAGGC1630.11733456186698724No Hit
GGGATTATTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTA1620.11661471792915296No Hit
GGGGAGTACTTCTGTGTTGTGAGCCTCAATGACATGCGCTTTGGAGCAGG1620.11661471792915296No Hit
GGGACAGTGACCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCC1610.11589487399131869No Hit
GGGGCTAAGACCACACAGCCAAATTCAATGGAGAGTAACGAAGAAGAGCC1610.11589487399131869No Hit
GGGATCAAAATTGTGCTCCACAGAGAGAAGATACCGGTGTCGGGAAGCAC1610.11589487399131869No Hit
GGGGGAGAATGGGAAGGGCGATAAGAGGAGGGGTTAGTGATATACCAGGG1600.1151750300534844No Hit
GGGGGAAGAATAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTC1590.11445518611565013No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG1590.11445518611565013No Hit
GGGGCACTCTGCCATGGGCTCCTGGACCCTCTGCTGTGTGTCCCTTTGCA1580.11373534217781585No Hit
GGGCAGAAGCCTGACCCTGCCGTGTACCAGCTGAGAGAC1570.11301549823998158No Hit
GGGGGATGATGGAAGTAGCTCTTATGGCTGGAGATTGCAGGTTTATGACT1570.11301549823998158No Hit
GGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAGC1560.11229565430214729No Hit
GGGAGGCTGAGATACCAGCATGGAGAAAATGTTGGAGTGTGCATTCATAG1550.11157581036431302No Hit
GGGGGAGCACAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAG1540.11085596642647873No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGTGGTGAACGAGAAACGGGCAGG1540.11085596642647873No Hit
GGGGTTTTTGTAGAGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTG1540.11085596642647873No Hit
GGGGGGTGAAGGATAGACGCTGTGGCTCTGCATGACTCACTAGCACTCTA1540.11085596642647873No Hit
GGGGGCATTTGATTGGTTGAGCAGCCAACAGAAAGGCTCTTTCCTGCATT1530.11013612248864446No Hit
GGGGGAATCACGTTTTGCCCAGGAAAACACACTTGATAACTGAAGGATGA1530.11013612248864446No Hit
GGGAGAGAAACTCCAGGATATGTTACTAACTTGGGTGAATGAGAAAATTG1530.11013612248864446No Hit
GGGGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCAGACTC1530.11013612248864446No Hit
GGGGTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTTGGAAAAGGCAC1530.11013612248864446No Hit
GGGAGAGAAGATGTTGAATACACAAGTCAACTTCTGGGAGCAGATCTCTG1520.10941627855081018No Hit
GGGGAAAAGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGC1520.10941627855081018No Hit
GGGGATTACTGTGACAATAACAATGACATGCGCTTTGGAGCAGGGACCAG1510.10869643461297591No Hit
GGGGACCACAGATCACTTGTCCCTGGAGATATAGCATCTGAGGACTGACT1510.10869643461297591No Hit
GGGAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCTGACTTTTGGGACCGG1500.10797659067514162No Hit
GGGGGAGCATCTCATTCGATTGTCTTTCTGATCAGGGGTGAGAAGCCAAC1490.10725674673730735No Hit
GGGGTTTTTTGACAGGATATGTAACACAGTGTGATTTATAACCAGGGAGG1490.10725674673730735No Hit
GGGGAGACTTCCACTAGAGGGGAAGGTGATCTCACTTGCTCAGCCTTCCC1480.10653690279947307No Hit
GGGGATTTCAGTTTGGAGAAGCAAAAAAGAACAGCTCCCTGCACATCACA1480.10653690279947307No Hit
GGGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAA1470.10581705886163881No Hit
GGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGC1470.10581705886163881No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGATTCAGCC1460.10509721492380451No Hit
GGGGATTTCTTTTTGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAG1460.10509721492380451No Hit
GGGGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTGAG1460.10509721492380451No Hit
GGGGACTATTGCATCGTCAGCGGCAGAGATGACAAGATCATCTTTGGAAA1460.10509721492380451No Hit
GGGGGGGAGACATCCTCTCTAGCCCCAACTGTGCCATGACTATCAGGCTC1450.10437737098597025No Hit
GGGGACTACTGTGCTGTTAAGGGTTCTGCAAGGCAACTGACCTTTGGATC1440.10365752704813597No Hit
GGGGATACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTCATCCG1440.10365752704813597No Hit
GGGGCGTGCTCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGT1430.1029376831103017No Hit
GGGAAAAGCAGATTCAGCCACCTACCTCTGTGCCGTGAACTTGGGCAGGA1430.1029376831103017No Hit
GGGGGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTT1420.1022178391724674No Hit
GGGGGTCCCTGGAGATATAGCATCTGAGGACTGACTGTCTAGCTTAGACT1420.1022178391724674No Hit
GGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCAC1420.1022178391724674No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAG1410.10149799523463314No Hit
GGGGGTACGTGAGCAGGAAACATGGAGAAGAATCCTTTGGCAGCCCCATT1410.10149799523463314No Hit
GGGGATTCTGAGTTCAAAGCAACTCCTGTTAAGGAAGCCCATTCAGAAGC1410.10149799523463314No Hit
GGGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGG1410.10149799523463314No Hit
GGGACCAATGCAGGCAAATCAACCTTTGGGGATGGGACTACGCTCACTGT1400.10077815129679885No Hit
GGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTG1400.10077815129679885No Hit
GGGGGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA1390.1000583073589646No Hit
GGGGAAAATGAGAAAGAAAAAAGGAAAGAAAGACTGAAGGTCACCTTTGA1390.1000583073589646No Hit

[OK]Adapter Content

Adapter graph