FastQCFastQC Report
Wed 8 May 2024
EGAF00004953454

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953454
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences61018
Total Bases9.6 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC48

[WARN]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN1011616.578714477695105No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC647410.609983939165492No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA22063.6153266249303484No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT15832.594316431217018No Hit
GGGGATGCTTGCATGTGTAATCTTACTAAGAGCTAATAGAAAGGCTAGGA14602.3927365695368583No Hit
GGGCTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACAT8561.402864728440788No Hit
GGGGTGACTTCCCTGGTCACCAAGGCAGTGCATGCATGTTGGGGTTTCCT6611.0832868989478515No Hit
GGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTG6461.0587039889868564No Hit
GGGGTTCAACGGGTTACCCGCGCCTGCCGGCGTAGGGTAGGCACACGCTG4280.701432364220394No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG3970.6506276836343374No Hit
GGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTA3830.6276836343374086No Hit
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAAT3230.5293519944934282No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA2420.3966042807040545No Hit
GGGACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATC2240.3671047887508604No Hit
GGGGAGGGGGTGATCTAAAACACTCTTTACGCCGGCTTCTATTGACTTGG2090.3425218787898653No Hit
GGGAAACCAAAAGAAGCCTCCAGACAGCCCTGAGATCACCTAAAAAGCTG2000.3277721328132682No Hit
GGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAGG1690.27696745222721164No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT1490.24419023894588482No Hit
GGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTT1460.2392736569536858No Hit
GGGCAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTA1440.23599593562555313No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC1430.23435707496148678No Hit
GGGGTATCTAATCCCAGTTTGGGTCTTAGCTATTGTGTGTTCAGATATGT1410.23107935363335408No Hit
GGGAGTGTGTGAGTGTGTTCACACACTCTTACACACATACACATATACAC1370.22452391097708874No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA1260.20649644367235898No Hit
GGGACACGTGGGGAGTGGGGTGGGGGGAGCTATTTCCAAGGCCCCTCCCT1230.20157986168015996No Hit
GGAAATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCA1180.19338555835982824No Hit
GGGAGGAAGAAAAGGAAAGTGAAGAAGCCATCCTAGCAGATGATGATGAA1160.19010783703169556No Hit
GGGCTAACAAACCCACAGGTCCTAAACTACCAAACCATCCG1160.19010783703169556No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA1150.18846897636762922No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA1150.18846897636762922No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT1120.1835523943754302No Hit
GGGGGAACAGAAAACCAAATACCACATGTTCTCACTTGTAAGTAGGAGCT1070.1753580910550985No Hit
GGGCACATACACTCACACTCACTCACATATACATAGACACATACTGATAC1060.17371923039103215No Hit
GGGCAGCAAATGGCAGTCCTCATCAAATTTTTAGGCTTTTCTTTTTTCTT1050.1720803697269658No Hit
GGGATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTAT1030.16880264839883313No Hit
GGGGATTGATTGTATTCAATTCCCTTACACTCCATTTCATTCCATTCCAT1030.16880264839883313No Hit
GGGATAGACTTACAACATGTAAGTCTATCCCAGACTACACCTCTGGACCT980.1606083450785014No Hit
GGGCGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAACTTTACT970.1589694844144351No Hit
GGGAGGATATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATC960.15733062375036874No Hit
GGGATGGACTGGAAAGCAAGTTCCATTCCACTCCCTTGCTTTCCAGTCCA940.15405290242223604No Hit
GGGGATTCATGGTCTAAAAAACAATGAAACCAATGAAATGGCCTCTCTGA940.15405290242223604No Hit
TCTATTCCATTCCTATCCACTTCATTCCATTCCAGTCCTCTCAACTGCAT900.14749745976597067No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG890.14585859910190435No Hit
GGGGAAATCAAAAAGGAAATTAAAAATGACAAAAAAATGAATACAACATA890.14585859910190435No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA870.14258087777377165No Hit
GGAATGGAATGGAATGGAACGGAATGGAATGGAATGGAACGGAATGGTAC870.14258087777377165No Hit
GGGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTTGG870.14258087777377165No Hit
GGGGACAAAAGGGAGTTTATTGTGAGGCATCAAACACTGTGATACTCACG860.14094201710970533No Hit
AGCACAGACTCTGGCCCTAATCTTACCTGAACCCATCTTCCTACCACGAG850.13930315644563898No Hit
GGGATTGATTCTATTCAACTCCCTTACATTCCATTACATTCCATTCCATT840.13766429578157263No Hit
GGGATTGACCCCCAGGACCCTTCTGCAAAGAGCAGCTTCTGTTCCTGTTT830.1360254351175063No Hit
GGGGCAGGCTGCCAGACCGGAAGCGCTCCGCTGTACCTGGATCCTGCTCC830.1360254351175063No Hit
GGGATTTCACTCTAGTCCATTCCATTCCATTCAATTCCATTCGACTCTAT830.1360254351175063No Hit
GAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGT820.13438657445343996No Hit
GGGTGTACAAACACACCCACACACACACCACACACACACTGCGTACACAC820.13438657445343996No Hit
GGGATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCT820.13438657445343996No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG810.1327477137893736No Hit
GGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCGG810.1327477137893736No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC810.1327477137893736No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA800.1311088531253073No Hit
GGGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTC790.12946999246124094No Hit
GGGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTC790.12946999246124094No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAACCATCCG770.12619227113310824No Hit
GGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGAA770.12619227113310824No Hit
AAGCTAATAAATAAAGTCTAACGCAAAGGGGAAAAAAAAGGAAACCAAAC770.12619227113310824No Hit
GGGAGGAAACAAACTCACCTTTGGGACAGGCACTCAGCTAAAAGTGGAAC760.12455341046904193No Hit
GGGAACCTGTATTTTATTTGGCAATCCTAGCCCAGCTTACTAGAAAACCT750.12291454980497558No Hit
GGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT750.12291454980497558No Hit
GGGGAGTGCAATCTGGGCGATCGCTTCCTGGTCCTCGCCTCCTCCGCTGT750.12291454980497558No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG740.12127568914090923No Hit
GGGATTTATTGCATTCCATTCCATTCCCTTCCATTCCAGTTGATACCATT740.12127568914090923No Hit
GGGAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCC730.1196368284768429No Hit
GGGTGCTTAAAATACATTGACTCCCTTCCTTCTATCCCTCATTCTATCTC730.1196368284768429No Hit
GGGATAGTGAAATGGATTTTGGCGTAGGTTTGGTCTAGGGTGTCTCCTCT730.1196368284768429No Hit
GGGATTAATCCCCTGGCCCAACCCGTCATCTACTCTACCATCTTTGCAGG730.1196368284768429No Hit
GGGACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTC730.1196368284768429No Hit
GGGGCAAAGACCTGATAGCACAAACATTATGCATGGGCCCAGTAGCATGA730.1196368284768429No Hit
GGGGCAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCAC720.11799796781277656No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT710.11635910714871021No Hit
GGGCACCACAAAATCTTTACCAAGTGAGCACCACAACCCGTGCACCCTCC710.11635910714871021No Hit
GGGAATGGAAAGGTCTAGACACCTTACTGGCATTCTCAATTTTATAATAA700.11472024648464388No Hit
GGGAATCCATTCGAGTACATTCCATTAAAGTTCATTCCATTCTAATACAT690.11308138582057754No Hit
GGGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAG690.11308138582057754No Hit
GGGGGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGGCTG680.1114425251565112No Hit
GGGACTACGCTCACTGTGAAGCCAAATATCCAGAACCCTGACCCTGCCGT680.1114425251565112No Hit
GGGAACAGAAAACCAAATACCACATGTTCTCACTTGTAAGTAGGAGCTAA670.10980366449244486No Hit
GGGCGGCCTCTCTTATACACAGCAGATTCCTCCTTATGGACAACAAGGCC670.10980366449244486No Hit
GGGTGAAGAGAGGGATGGGACAACCTAGTAGGAGGGAGGTAGGGATAGGC670.10980366449244486No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT660.10816480382837851No Hit
GGGGAATAATTGCAATCCCCGATCCCCATCACGAATGGGGTTCAACGGGT660.10816480382837851No Hit
GGGAAATGAAGAAACAGGAAAATACGTTTCAAACAACAACAACAACAACA660.10816480382837851No Hit
GGGACTTTCGGGGCCGGCAGCAGGCTGACCGTGCTGGAGGACCTGAAAAA660.10816480382837851No Hit
GGGATTTCATTCGAGTCCCTTTCATTCCATTCCATTCCATTCCATTCGAG660.10816480382837851No Hit
GGGACTCAGAACTTGTCACTCCTGCTCAAAAACTTCCAGTTTCACCCAGG650.10652594316431217No Hit
GGGGGTTAGTCCTTGCTATATTATGCTTGGTTATAATTTTTCATCTTTCC650.10652594316431217No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT640.10488708250024582No Hit
GGGGAAGTCCAGCCCAGAAGAAATCAGGAAATAGGGCTCAGGGGCACGTG640.10488708250024582No Hit
GGGACTTTTTTATATAATTATTTCTTTTCTTTCAGATGCCTAGTAGTATA630.10324822183617949No Hit
GGGGATATTCCGAAATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCA630.10324822183617949No Hit
GGGACCCAACACTTGACCAAATGGACCTATGAGACATCTACAGAATATTT630.10324822183617949No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT620.10160936117211315No Hit
GGGCATGGCTACGTTCCAATAAAACTATTTACGAAAACAGCATAGTGTCT620.10160936117211315No Hit
GGGGAAATAGAGTGGCAGAAGCAGCTCCTTGAGAGGGATAAACGAGAAAT620.10160936117211315No Hit
GGGTGCAGCACACCAACATGGCACATGTGTACATATGTAACAAACCTGCA620.10160936117211315No Hit

[OK]Adapter Content

Adapter graph