FastQCFastQC Report
Wed 8 May 2024
EGAF00004953496

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953496
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences229628
Total Bases46.5 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT45561.984078596686815No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC38561.6792377236225546No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT31511.3722194157506924No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC29991.306025397599596No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC22840.9946522201125299No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA20380.8875224275785182No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT18030.7851829916212308No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT16910.7364084519309492No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA16260.7081017994321249No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG15210.6623756684724859No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN14270.621439894089571No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG14090.6136011287822043No Hit
GGGACACCAGCTCCTCTGGGGTTTGCCACACTCATGATGCACTGTGTAGC12310.536084449631578No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG11330.4934067274025815No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT11070.4820840664030519No Hit
GGGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCAC10930.4759872489417667No Hit
GGGACTTCGGGCCAGGCACGCGGCTCCTGGTGCTCGAGGACCTGAAAAAC10510.45769679655791107No Hit
GGGCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGA10400.45290643998118696No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA10140.4415837789816573No Hit
GGGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGT10100.43984183113557584No Hit
GGGGGACAGTAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGT9950.43330952671277023No Hit
GGGGAAGAAACCATCTGCCCTTGTGAGCGACTCCGCTTTGTACTTCTGTG9740.42416430052084236No Hit
GGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCT9520.4145835873673942No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG9490.41327712648283305No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA9130.3975995958680997No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT8780.38235755221488665No Hit
GGGAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGA8540.37190586513839774No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA8540.37190586513839774No Hit
GGGGGAAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGTGC8390.3653735607155922No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT8130.35405089971606246No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC8070.35143797794694026No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG8010.34882505617781806No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA7970.34708310833173656No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT7920.3449056735241347No Hit
GGGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATG7880.3431637256780532No Hit
GGGACAAGAAGTGACTCTGAGATGTAAACCAATTTCAGGACACGACTACC7860.34229275175501245No Hit
GGGGATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAA7860.34229275175501245No Hit
GGGATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGA7550.32879265594788093No Hit
GGGAAGGAGCTCAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAA7220.31442158621770866No Hit
GGGGACTGAAGCTTTCTTTGGACAAGGCACCAGACTCACAGTTGTAGAGG7160.3118086644485864No Hit
GGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTA7120.31006671660250495No Hit
GGGACACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATG6560.2856794467573641No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT6510.2835020119497622No Hit
GGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTT6400.27871165537303816No Hit
GGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGG6350.27653422056543625No Hit
GGGGAGTGCAGTGCTAATGCTGGTGGTACTAGCTACGGAAAGCTGACATT6260.27261483791175295No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC6230.2713083770271918No Hit
GGGGAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAA6190.2695664291811103No Hit
GGGAGTAGAGTCTGGAGAGTTTAGAATGATGGTTTTTGCAATGACTTAGA6180.26913094221958994No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT6090.2652115595659066No Hit
GGGGGGAGTTACCAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTCAT6050.26346961171982514No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC6020.262163150835264No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT5940.25867925514310103No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC5870.2556308464124584No Hit
GGGACGCGCATGAATGGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTT5830.2538888985663769No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC5790.2521469507202954No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA5620.24474367237444913No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG5600.24387269845140835No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCAC5580.24300172452836763No Hit
GGGTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC5520.24038880275924537No Hit
GGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGAG5360.23342101137491944No Hit
GGGACAACAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCG5350.2329855244133991No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG5260.2290661417597157No Hit
GGGAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAA5240.22819516783667498No Hit
GGGGGGAAGGGGACCAAACTCTCGGTCATACCAAAGGCCTGAGTCAAGGT5200.22645321999059348No Hit
GGGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGA5180.22558224606755276No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC5080.22122737645234902No Hit
GGGAGACTGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCA5040.21948542860626752No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA4990.21730799379866567No Hit
GGGATTTTTTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGT4940.2151305589910638No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG4910.21382409810650269No Hit
GGGAGAAATGTGTTCAGGCAGACTGGATGTGTTTTTGACAGGATATGTAA4900.2133886111449823No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA4870.21208215026042118No Hit
GGGAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCTCGAGG4840.21077568937586005No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT4830.21034020241433973No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG4810.20946922849129898No Hit
GGGGAGTCCTGCTCCCCTTTCATCAATGCACAGATACAGAAGACCCCTCC4790.2085982545682582No Hit
GGGAGGCATCAAACACTGTGATACTCACGGGAGGAGAAAACAAACTCACC4740.20642081976065635No Hit
GGGGAGTGAGGGAGTGAACACCAGATGGAAAGTCAAGCAACAGGTTTCTG4740.20642081976065635No Hit
GGGGACAGTGACCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACTCTGT4710.20511435887609525No Hit
GGGGAGTCTAAGTGACAGAAGGAATGGAGACCCTGGGAAAGGTCTCACAT4710.20511435887609525No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC4650.202501437106973No Hit
GGGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCAC4650.202501437106973No Hit
GGGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAG4640.20206595014545264No Hit
GGGATATATCACAGCCTCCCAGCCTGCAGACTCAGCTACCTACCTCTGTG4640.20206595014545264No Hit
GGGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTT4640.20206595014545264No Hit
GGGAGTGTAAATACCGGCACTGCCAGTAAACTCACCTTTGGGACTGGAAC4630.20163046318393227No Hit
GGGAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAAC4580.19945302837633042No Hit
GGGAGAGGAAATGGAGAGAGATGGGAGGCAGGAAGCCGGACCTCGGGGGA4570.19901754141481No Hit
GGGATTATTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTA4530.19727559356872856No Hit
GGGGAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGG4480.1950981587611267No Hit
GGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATA4460.19422718483808596No Hit
GGGAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTCATACCAAAGGCC4410.19204975003048408No Hit
GGGAGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTAT4370.1903078021844026No Hit
GGGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTAT4360.18987231522288223No Hit
GGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTG4350.18943682826136185No Hit
GGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTC4340.18900134129984147No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA4330.18856585433832113No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA4330.18856585433832113No Hit
GGGAAGAAGAAGCATGGAAGATTAATTGCCACAATAAACATACAGGAAAA4310.18769488041528037No Hit
GGGATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACC4300.18725939345376No Hit
GGGGGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGGCTG4210.18334001080007664No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGT4190.1824690368770359No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA4180.18203354991551554No Hit
GGGAAAGCCTTCTGTGGCTGTGAGAATAGTGGAGGTAGCAACTATAAACT4170.18159806295399517No Hit
GGGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTG4160.1811625759924748No Hit
GGGGAAAAGCAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATA4150.1807270890309544No Hit
GGGGAAAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCT4110.17898514118487294No Hit
GGGGGGAGACTTCCACTAGAGGGGAAGGTGATCTCACTTGCTCAGCCTTC4080.1776786803003118No Hit
GGGGGTGACAATAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGAC4080.1776786803003118No Hit
GGGGGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT4080.1776786803003118No Hit
GGGATTACTGTACTCCTATCTTTGGCTTCCCTCCCAGGGTCCAGAGTACG4060.17680770637727106No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA4040.1759367324542303No Hit
GGGGAGCCCAGAGAAGTCTGTTCCAGGACGGGCTCTTTCAGGAGCAGCTA4030.17550124549270996No Hit
GGGAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAG4020.17506575853118958No Hit
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAAT3990.17375929764662845No Hit
GGGGAGAGGAGTTTATGTAAAGGGTTGGCCCAGAGTGTGTATTCAGGAGG3990.17375929764662845No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT3980.1733238106851081No Hit
GGGGGTACATTTCCTCTTCCCAGACCACAGACTCAGGCGTTTATTTCTGT3950.17201734980054698No Hit
GGGTGAGCAGCAAACAGGAGGTGACACAGATTCCTGCAGCTCTGATAGCG3940.1715818628390266No Hit
GGGGGACTTTCTACAACTCAGAGAGTATTCAGGAGGGTTTCCCAGGATGT3900.16983991499294512No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT3890.16940442803142472No Hit
GGGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGC3840.16722699322382287No Hit
GGGGAATGCAATTATACAGTGAGCCCCTTCAGCAACTTAAGGTGGTATAA3840.16722699322382287No Hit
GGGGAACACTGTGTATCTAACTTTGGAAATGAGAAATTAACCTTTGGGAC3830.16679150626230252No Hit
GGGAGACTGCTGTCTGCACAAGAAGAAGACTTACAGATGCTTAAGGAGGA3820.16635601930078214No Hit
GGGGACAAAGAATTCAATTCTCAATGTCTTCAGAGTTGAACTTGACAACT3820.16635601930078214No Hit
GGGAGATGCAGTGCTTCCTGTCCCTCTGTGCCATGGGCCCCGGGCTCCTC3790.16504955841622101No Hit
GGGGTAACCTCTGGCTGTCTCTTCTGCCTGGTTTTTGTTGAGCTTCCTAT3790.16504955841622101No Hit
GGGGATTGACCCCCAGGACCCTTCTGCAAAGAGCAGCTTCTGTTCCTGTT3790.16504955841622101No Hit
GGGAGCCCAGAGAAGTCTGTTCCAGGACGGGCTCTTTCAGGAGCAGCTAA3780.16461407145470067No Hit
GGGGGGAAAAGCCCTGAGTTGATAATGTTCATATACTCCAATGGTGACAA3770.16417858449318026No Hit
GGGATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCT3760.16374309753165991No Hit
GGGGGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATCTTC3740.16287212360861916No Hit
GGGGGGACTAGGCTCATAGTAACTTCGCCTGATAAACAACTTGATGCAGA3730.1624366366470988No Hit
GGGAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAG3730.1624366366470988No Hit
GGGGAGGCTGAATTTAAGAGGAGTCAATCTTCCTTCAACCTGAGGAAACC3710.16156566272405803No Hit
GGGAGAGACACATAACACTGTGACTACCTCAGGAACCTACAAATACATCT3700.16113017576253766No Hit
GGGAGAAAGAAAATATCATAGATGAGTCAGGAATGCCAAAGGAACGATTT3700.16113017576253766No Hit
GGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATC3650.1589527409549358No Hit
GGGGGTTTTTGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTC3650.1589527409549358No Hit
GGGATCTCAGTGACTTGATTATGAAATGCTACCAGTTTGAAGCAGTCACT3620.15764628007037468No Hit
GGGAGAGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGG3620.15764628007037468No Hit
GGGGGCTGTTGCTCACAGTGACCCTGATTGGGCAAAGCTCCCATCCTTCC3610.15721079310885433No Hit
GGGGCTCCTACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTG3590.15633981918581358No Hit
GGGAAAAACTCTGTGCATACTCTGGGGCTGGGAGTTACCAACTCACTTTC3590.15633981918581358No Hit
GGGGTTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC3590.15633981918581358No Hit
GGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCAC3590.15633981918581358No Hit
GGGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTT3580.1559043322242932No Hit
GGGGATTATTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGT3580.1559043322242932No Hit
GGGGAGAGACACTGCTGTGTACTATTGCATCGTCAGAGTCGTAACCGGCA3570.15546884526277283No Hit
GGGGGGGGAACACCATATATTTTGGAGAGGGAAGTTGGCTCACTGTTGTA3510.1528559234936506No Hit
GGGGGGTGGAGAAGTGAAGAAGCTGAAGAGACTAACCTTTCAGTTTGGTG3490.15198494957060985No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAAGATACAAGA3460.15067848868604874No Hit
GGGGAAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG3450.15024300172452837No Hit
GGGGAGTTTCTTCTTCCTGCAGCTGGTTGAGTTCTTTCCAGACAAAGACA3420.14893654083996724No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA3390.1476300799554061No Hit
GGGGAGCACAGTGTTTAAGAAACCAGTGGCTCTAGGTTGACCTTTGGGGA3380.14719459299388576No Hit
GGGGACAAATACATCTTTGGAACAGGCACCAGGCTGAAGGTTTTAGCAAA3320.14458167122476354No Hit
GGGCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTGC3310.14414618426324316No Hit
GGGAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGA3300.14371069730172278No Hit
GGGGAGCTGCACATGGTCACAGCTGCTCTAAGCCCTGGAGCTCCTTCCCA3300.14371069730172278No Hit
GACCAGACTGACAGTAAAACCAAATATCCAGAACCCTGACCCTGCCGTGT3290.1432752103402024No Hit
GGGAGTCTCTCTGATTGCTTTTGCTTTGGTGCTCTGGACATAAACTGTTC3280.14283972337868206No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGA3280.14283972337868206No Hit
GGGAAGGAGGTGCACAGTGGGGTCCATGGATGCTGATGTTACCCAGACCC3270.14240423641716166No Hit
GGGACAGAAAAAAAAAATGAAGAAGCTACTAGCAATGATTCTGTGGCTTC3260.1419687494556413No Hit
GGGGGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGC3250.14153326249412093No Hit
GGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGCAG3230.14066228857108018No Hit
GGGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT3200.13935582768651908No Hit
GGGGAGACTCAGCTACCTACCTCTGTGCTCTAGACGGGGGTTCTGCAAGG3190.13892034072499868No Hit
GGGACCAGGCTCACTGTGACAGAGGACCTGAACAAGGTGTTCCCACCCGA3190.13892034072499868No Hit
GGGGGAAGAAGCTACTAGCAATGATTCTGTGGCTTCAACTAGACCGGTTA3170.13804936680195795No Hit
GGGACCCACATGAAGTGTCTACCTTCTGCAGACTCCAATGGCTCAGGAAC3140.13674290591739682No Hit
GGGGACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGAATA3140.13674290591739682No Hit
GGGGATATTCCGAAATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCA3130.13630741895587647No Hit
GGGGGACAGACAGATGCTTCATTCCTGTATGGGGTGGTATTCCTGCCATG3120.1358719319943561No Hit
GGGACTCGCTTTTGGGAAGGGGAACCAAGTGGTGGTCATACCAACCACAT3110.13543644503283572No Hit
GGGGGCCACTCTGTGTCTCTTTTTGTCACCTGCCTGAGTCTTGGGCAAGC3090.13456547110979497No Hit
GGGAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGGG3080.1341299841482746No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG3080.1341299841482746No Hit
GGGGATAGGACTGTGTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTT3070.13369449718675422No Hit
GGGGGATCTGGTTTTTGTTGTTGAGCAAATCATAGTGTTTCTTCTGGTTC3060.13325901022523387No Hit
GGGGAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGG3030.13195254934067274No Hit
GGGACACCGGTAACCAGTTCTATTTTGGGACAGGGACAAGTTTGACGGTC3030.13195254934067274No Hit
GGGAGAGTGGAGAAGTGAAGAAGCAGAAAAGACTGACATTTCAGTTTGGA3030.13195254934067274No Hit
GGGGGCCACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGG3030.13195254934067274No Hit
GGCCAGAAGCTGCTCTTTGCAAGGGGGACCATGTTAAAGGTGGATCTTAA3020.13151706237915237No Hit
GGGGCATTTGATTGGTTGAGCAGCCAACAGAAAGGCTCTTTCCTGCATTA3020.13151706237915237No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA3000.13064608845611161No Hit
GGGCAGGAGAGCACTTACTTTTGGGAGTGGAACAAGACTCCAAGTGCAAC3000.13064608845611161No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG3000.13064608845611161No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT2980.1297751145330709No Hit
GGGAGATGCAAATCAAGAGCCAACCATGCAAGCAGTCCCTTCTAAGGCCA2960.12890414061003014No Hit
GGGAGACACTGCTTCTTACTTCTGTGCTACGCCCGCTGGTGGTACTAGCT2950.12846865364850976No Hit
GGGGAGGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAACCAAA2950.12846865364850976No Hit
GGGAAACAGAGTGGGAAGGAACTACGCTGTAGGAAGGAAAGATGAACTTG2940.12803316668698939No Hit
GGGGGAAATGTGATTTACCTGGGTCCTGCCATGGTTTCCAGGCTTCTCAG2920.12716219276394863No Hit
GGGGGAGTGAGGGAGTGAACACCAGATGGAAAGTCAAGCAACAGGTTTCT2910.12672670580242829No Hit
GGGGAGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTG2900.1262912188409079No Hit
GGGATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGAC2900.1262912188409079No Hit
GGGGTTGTTGTTACAGTCTGAGCTTTTGTCAGAGCTGCTCCTATGCTGTG2900.1262912188409079No Hit
GGGGAGACTGCTGTCTGCACAAGAAGAAGACTTACAGATGCTTAAGGAGG2890.12585573187938753No Hit
GGGACTGGTGACAGGTGTCTGCCCTGTTTCTGTAAAGCTGCTGACAGCCG2890.12585573187938753No Hit
GGGGAACCCTGGGGAGGCTATACTTTGGAAGAGGAACTCAGTTGACTGTC2880.12542024491786716No Hit
GGGGGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAG2870.12498475795634678No Hit
GGGTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCATGCCCTGGCTTC2870.12498475795634678No Hit
GGGACCTTTAGAAAGAGAGATGCTGAACATGAGAAATCAGTAAGCCTCAA2850.12411378403330606No Hit
GGGGAGGACAGATTCTTTTTACGATTCCTAAAGTGGAAGAAATAAAGTAT2850.12411378403330606No Hit
GGGGGGTTGGCCCAGACTGTGTATTCAGGAGGAGGTGCTGACGGACTCAC2840.12367829707178567No Hit
GGGAGAACTGGCAGACACCTGCCTGATGCTGCCATGGGCCCCCAGCTCCT2830.1232428101102653No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT2820.12280732314874493No Hit
GGGGGCTGCTGACAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCTGACTT2820.12280732314874493No Hit
GGGAGTGGCTCTAGGTTGACCTTTGGGGAAGGAACACAGCTCACAGTGAA2810.12237183618722457No Hit
GGGGAGTGTGAATTCTGGGGGTTACCAGAAAGTTACCTTTGGAACTGGAA2810.12237183618722457No Hit
GGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGC2800.12193634922570418No Hit
GGGGAGAGATACTTGATAATATAGCTCTCTTGGCTGGAGATTGCAGGTCC2780.12106537530266344No Hit
GGGAAGCATTCTGGTGAGACCAACTGCATTTTGGCCATGGCTTTGCAGAG2750.11975891441810232No Hit
GGGGCTTTTTCACAGGGGTTTGGAGCCAACGGAAGGAGGTGGAGCAGGAT2750.11975891441810232No Hit
GGGGTTTTATCAAAGGCTGTCCTCACTGTGTGCATCAGGAGGAAGCTACA2750.11975891441810232No Hit
GGGAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGC2750.11975891441810232No Hit
GGGGGACAACAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTT2740.11932342745658196No Hit
GGGGACTACTGTGCTGTGGTTGGTGGCCAGAAGCTGCTCTTTGCAAGGGG2740.11932342745658196No Hit
GGGAGGTATGGCAGGGAGGGAAGGAGAAACTTAGGGGGACTGTTTATTGC2740.11932342745658196No Hit
GGGGGGCGGTGTGGCTAGGGCTTCTCCTCAACTCTCTCTGGAAGGTTGCA2730.11888794049506157No Hit
GGGGAGCTGGTTGAGTTCTTTCCAGACAAAGACAAGTGACAAGAATTAGA2730.11888794049506157No Hit
GGGGGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGC2730.11888794049506157No Hit
GGGGTTTTTGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCT2730.11888794049506157No Hit
GGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGACTGAGAAGGCTCACGAA2720.1184524535335412No Hit
GGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAATCA2720.1184524535335412No Hit
GGGGAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAAC2720.1184524535335412No Hit
GGGACTAGGCTCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGG2710.11801696657202083No Hit
GGGGAGGCAGCACAGTGCTGTGATTTATAGCACATTCATCTTTGGGAGTG2690.11714599264898008No Hit
GGGGAGAAATGTTTGAACATATGAGAGAGCAAAGCAGAGTGTTTATCTTG2690.11714599264898008No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA2660.11583953176441898No Hit
GGGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCA2660.11583953176441898No Hit
GGGGTGAATCAACACGGGCAGGAGAGCACTTACTTTTGGGAGTGGAACAA2650.11540404480289859No Hit
GGGGGCAGAGGGCAGGATTTTGTACTGTGATGTACCAGGGTGTGGACACG2640.11496855784137823No Hit
GGGGATGTTCACAGAGGGCCTGGTCTGGAATATTCCACATCTGCTCTCAC2640.11496855784137823No Hit
GGGAAAAAAACGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGA2640.11496855784137823No Hit
GGGGAGAGGAAATGGAGAGAGATGGGAGGCAGGAAGCCGGACCTCGGGGG2640.11496855784137823No Hit
GGGGAGATAAGACAATCTGCATCTTCACAGGAGGGATGGCCATGCTCCTG2630.11453307087985785No Hit
GGGGCTTTTCAGTTTGGTGATGCAAGAAAGGACAGTTCTCTCCACATCAC2620.11409758391833749No Hit
GGGGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCA2600.11322660999529674No Hit
GGGGGATTTGAGACGGAGCACGGAACATTTCACTCAGGGGAAGAGCTATG2570.11192014911073561No Hit
GGGGGGCTTCTGGGTGTTTTTGACTGACTAAGAAACACTGTGGGATGGAT2570.11192014911073561No Hit
GGGAGAGAGAAGATACCGGTGTCGGGAAGCACCAGTGCCCTGAGGAAGGG2570.11192014911073561No Hit
GGGAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTGCTCCTTCTC2570.11192014911073561No Hit
GGGGGCAGAAACACTGTGTCAAACTGGGGCAAACAACCTCTTCTTTGGGA2560.11148466214921525No Hit
GGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAA2550.11104917518769489No Hit
GGGGATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGGTT2550.11104917518769489No Hit
GGGGGATACTGGAGGCTTCAAAACTATCTTTGGAGCAGGAACAAGACTAT2550.11104917518769489No Hit
GGGGGGGTGTTTTTGACTGACTAAGAAACACTGTGGGATGGATAGCAGCT2540.11061368822617451No Hit
GGGGATAATCTGCCTCCTCACTCCCTTCTTGGCTCATCCTCCCTCTTATG2510.1093072273416134No Hit
GGGAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCACGCTCGA2500.10887174038009304No Hit
GGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGG2500.10887174038009304No Hit
GGGAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTCTGCTGTGCGGTTCT2490.10843625341857265No Hit
GGGGTTTCTGTAAAGCCTTCTGTGGCTGTGAGAATAGTGGAGGTAGCAAC2490.10843625341857265No Hit
GGGGATGTTGTGGAAGCATTGCAGGAAGGAGATTTGCAAGAAACGGGGCA2480.10800076645705228No Hit
GGGAGCCCCTTCCCACTGTGCTCCTACAATGAGCAGTTCTTCGGGCCAGG2470.1075652794955319No Hit
GGGAGATTAAGCGCCACGACTGTCGCTACGGAACGCTACAGCTTATTGTA2470.1075652794955319No Hit
GGGATACAACATGACCTATGAACGGTTCTCTTCATCGCTGCTCATCCTCC2460.10712979253401152No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT2460.10712979253401152No Hit
GGGATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGGCCTGGT2450.10669430557249115No Hit
GGGGGTCTGTTCCACCATATCTCTTCTGGTATGTGCAATACCCCAACCAA2440.10625881861097079No Hit
GGGAAAACACACTTGATAACTGAAGGATGATGAAGTGTCCACAGGCTTTA2420.10538784468793003No Hit
GGGGAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTC2410.10495235772640966No Hit
GGGGGAAGACCACCTGGGCTGTCATTGAGCTCTGGTGCCAGGAGGAATGG2400.1045168707648893No Hit
GGGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCAT2400.1045168707648893No Hit
GGGAGAAATGTTTGAACATATGAGAGAGCAAAGCAGAGTGTTTATCTTGT2380.10364589684184855No Hit
GGGGGATGCCGCGATGTATTTCTGTGCTTAAGACAACTTTGGAAATGAGA2370.10321040988032817No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC2350.10233943595728745No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGGGACACGGC2350.10233943595728745No Hit
GGGTTATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTC2340.10190394899576706No Hit
GGGATTATTTTTTTTTCGTGTTTAAGGTTTGAATCCTCAGTGAACCAGGG2330.1014684620342467No Hit
GGGGAGACTGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGC2330.1014684620342467No Hit
GGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTTG2320.10103297507272632No Hit
GGGAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGAC2320.10103297507272632No Hit
GGGGAGGAAACACCATATATTTTGGAGAGGGAAGTTGGCTCACTGTTGTA2310.10059748811120596No Hit
GGGGGTACCAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTG2310.10059748811120596No Hit
GGGAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTCT2300.10016200114968557No Hit
GGGATGTTTAGATACGATGCTAAATGCATGACATGTAGAATTGTTCATCT2300.10016200114968557No Hit

[OK]Adapter Content

Adapter graph