FastQCFastQC Report
Wed 8 May 2024
EGAF00004953518

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953518
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences59902
Total Bases12.2 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC50

[WARN]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT8621.43901706119996No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC7711.287102267036159No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC7221.205301993255651No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT5700.9515542052018297No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA4720.7879536576408133No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG4670.7796066909285166No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT4400.7345330706821142No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA4090.6827818770658742No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA3980.6644185502988214No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA3700.6176755367099597No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC3450.5759407031484759No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG3190.5325364762445327No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA3110.519181329504858No Hit
GGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAGC3050.5091649694501018No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC2660.4440586290941872No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT2550.4256953023271343No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC2530.4223565156422156No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC2470.4123401555874595No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA2410.4023237955327034No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA2400.40065440219024406No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG2390.3989850088477847No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC2360.39397682882040663No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT2340.390638042135488No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT2330.3889686487930286No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA2180.36392774865613836No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA2120.35391138860138227No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA2100.35057260191646356No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT2090.3489032085740042No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT2080.34723381523154484No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG2030.3388868485192481No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT2030.3388868485192481No Hit
GGGGAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAA1990.3322092751494107No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT1980.3305398818069513No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC1970.328870488464492No Hit
GGGAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCT1950.3255317017795733No Hit
GGGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCAT1930.32219291509465464No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG1810.3021601949851424No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT1780.29715201495776433No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC1690.2821274748756302No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA1680.28045808153317087No Hit
GGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTT1670.2787886881907115No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT1620.2704417214784147No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT1620.2704417214784147No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG1600.26710293479349606No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT1560.26042536142365863No Hit
GGGACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCA1490.2487396080264432No Hit
GGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG1440.24039264131414645No Hit
GGGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGAT1390.2320456746018497No Hit
GGGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA1390.2320456746018497No Hit
GGGACACCAGCTCCTCTGGGGTTTGCCACACTCATGATGCACTGTGTAGC1390.2320456746018497No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT1350.22536810123201229No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG1330.2220293145470936No Hit
GGGAGTAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGG1270.21201295449233748No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA1250.2086741678074188No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA1250.2086741678074188No Hit
GGGTAAAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACA1180.19698841441020332No Hit
GGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGG1180.19698841441020332No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT1180.19698841441020332No Hit
GGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTT1170.195319021067744No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGGTGTGACTACCCCGGTTGAGA1150.19198023438282527No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTC1140.19031084104036594No Hit
GGGAAGAAGAAGCATGGAAGATTAATTGCCACAATAAACATACAGGAAAA1130.18864144769790658No Hit
GGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCT1100.18363326767052854No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT1100.18363326767052854No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGA1090.18196387432806918No Hit
GGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAA1080.18029448098560982No Hit
GGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTGA1040.17361690761577242No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGG1040.17361690761577242No Hit
GGGAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCTC1030.17194751427331306No Hit
GGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTG1010.16860872758839437No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTC990.16526994090347566No Hit
GGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGAGGACCT980.16360054756101633No Hit
GGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATTT980.16360054756101633No Hit
GGGGTGGAAGGAAGGGCCCACACCAGCTCCTCTGGGGTTTGCCACACTCA970.16193115421855697No Hit
GGGGAGAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA970.16193115421855697No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA970.16193115421855697No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT960.16026176087609761No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG950.15859236753363826No Hit
GGGGAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGC950.15859236753363826No Hit
GGGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA940.15692297419117893No Hit
GGGTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC930.15525358084871957No Hit
GGGGAGTACTTCGGGCCGGGCACCAGGCTCACGGTCACAGAGGACCTGAA920.15358418750626024No Hit
GGGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTC920.15358418750626024No Hit
GGGATATTTCTGCGCCAGCAGTGGAGGACAGAGCAATCAGCCCCAGCATT910.15191479416380085No Hit
GGGCACAGGGAAAAGTGGGTCCACAGTGTCCCTTTTAGAGTGGCTATATT910.15191479416380085No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG910.15191479416380085No Hit
GGGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTT910.15191479416380085No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN900.15024540082134152No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT900.15024540082134152No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA900.15024540082134152No Hit
GGGGAGACTGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGC900.15024540082134152No Hit
GGGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTT890.14857600747888217No Hit
GGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGG890.14857600747888217No Hit
GGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGAGTCTGGGACAGCAGAG880.14690661413642284No Hit
GGGAGACACCTGCCTGATGCTGCCATGGGCCCCCAGCTCCTTGGCTATGT870.14523722079396345No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGGC870.14523722079396345No Hit
GGGTACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA870.14523722079396345No Hit
GGGGAGCATTGTGCCGACAGAGGCTCAACCCTGGGGAGGCTATACTTTGG870.14523722079396345No Hit
GGGCTGGTGACCCCAAAGCAAGGAGGACCTAGTAACATAATTGTGCTTCA870.14523722079396345No Hit
GGGGACAGGAGGGATGGCCATGCTCCTGGGGGCATCAGTGCTGATTCTGT850.14189843410904476No Hit
GGGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTA850.14189843410904476No Hit
GGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTT840.14022904076658543No Hit
GGGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAAC840.14022904076658543No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG840.14022904076658543No Hit
GGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTC830.13855964742412608No Hit
GGGAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCT830.13855964742412608No Hit
GGGAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAA810.13522086073920736No Hit
GGGAAACATTAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGAC800.13355146739674803No Hit
GGGGGACTTGATTATGAAATGCTACCAGTTTGAAGCAGTCACTGAAAAAC800.13355146739674803No Hit
GGGAGAACCAGACAGCTCTCAGAGCAACCCTGGCTCCAACCCCTCTTCCC780.13021268071182932No Hit
GGGAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCTGTGAGTGATC780.13021268071182932No Hit
GGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCCT780.13021268071182932No Hit
GGGGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGT770.12854328736936996No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA760.12687389402691063No Hit
GGGGACAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTG760.12687389402691063No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT760.12687389402691063No Hit
GGGAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAAC760.12687389402691063No Hit
GGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGC760.12687389402691063No Hit
GGGGGAGAAGGCTCTAGGCTGACCGTACTGGAGGACCTGAAAAACGTGTT750.12520450068445127No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA750.12520450068445127No Hit
GGGGAAAAAAGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGG750.12520450068445127No Hit
GGGAGTAGAGTCTGGAGAGTTTAGAATGATGGTTTTTGCAATGACTTAGA740.12353510734199193No Hit
GGGGAGATGCAGCCCAATGAAAGGACACAGTCATGTTTACTGGTATCGGC740.12353510734199193No Hit
GGGGCACAGCCTCGGGGCAGGGCCAGGGTAGTGATGGGGGCTGTGGCTTC740.12353510734199193No Hit
GGGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAG740.12353510734199193No Hit
GGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAG730.12186571399953255No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT730.12186571399953255No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC730.12186571399953255No Hit
GGGGAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCT720.12019632065707322No Hit
GGGGAGACAAATCAGGGCTGCCCAGTGATCGCTTCTCTGCAGAGAGGACT710.11852692731461387No Hit
GGGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCA710.11852692731461387No Hit
GGGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGA700.11685753397215452No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT700.11685753397215452No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT700.11685753397215452No Hit
GGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGATT700.11685753397215452No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC690.11518814062969517No Hit
GGGAGACACAGAGTCTGAGTTCTGGGGCCTGGAACCTCAATGTGCACTTG690.11518814062969517No Hit
GGGACAGTGGCTCAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCCT690.11518814062969517No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGCATGTGAAAAGGTCCAGAG680.11351874728723582No Hit
GGGGGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCCATGGGCACCA680.11351874728723582No Hit
GGGAGAGAAGAATGATGAAATCCTTGAGAGTTTTACTAGTGATCCTGTGG680.11351874728723582No Hit
GGGGAAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG670.11184935394477646No Hit
GGGGCAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTG670.11184935394477646No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC670.11184935394477646No Hit
GGGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTA670.11184935394477646No Hit
GGGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCAC670.11184935394477646No Hit
GGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATC670.11184935394477646No Hit
GGGACACAGCTATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGA670.11184935394477646No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCC670.11184935394477646No Hit
GGGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACG670.11184935394477646No Hit
GGGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATT660.11017996060231712No Hit
GGGGAGCAGTACGTCGGGCCGGGCACCAGGCTCACGGTCACAGAGGACCT660.11017996060231712No Hit
GGGGGAGGAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGT660.11017996060231712No Hit
GGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTT660.11017996060231712No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGG650.10851056725985776No Hit
GGGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTGGGCCTCCAGGCT650.10851056725985776No Hit
GGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACC650.10851056725985776No Hit
GGGGGAGGAACGGGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACT640.10684117391739842No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC640.10684117391739842No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG640.10684117391739842No Hit
GGGAAAGCTCCCATCCTTCCCTGACCCTGCCATGGGCACCAGGCTCCCCT630.10517178057493906No Hit
GGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGA620.10350238723247972No Hit
GGGTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAAC620.10350238723247972No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT610.10183299389002036No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA600.10016360054756102No Hit
GGGGATTCCTGTATGGGGTGGTATTCCTGCCATGGGTCCTGGGCTTCTCC600.10016360054756102No Hit
GGGGACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCA600.10016360054756102No Hit
GGGGAATATGAAGGCTGCAGCGATGCCTGCAAGTCAGCTTTTGCTACACT600.10016360054756102No Hit
GGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT600.10016360054756102No Hit
GGGAGAAAAAAAAAATGAAGAAGCTACTAGCAATGATTCTGTGGCTTCAA600.10016360054756102No Hit
GGGCTTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTG600.10016360054756102No Hit
GGGAGATTAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCATC600.10016360054756102No Hit

[OK]Adapter Content

Adapter graph