FastQCFastQC Report
Tue 7 May 2024
EGAF00004953536

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953536
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11381
Total Bases1.8 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC47

[FAIL]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN474341.674721026271854No Hit
GGGGTTCAACGGGTTACCCGCGCCTGCCGGCGTAGGGTAGGCACACGCTG3262.8644231614093663No Hit
GGGGTTTATCGATTACAGAACAGGCTCCTCTAGAGGGATATGAAGCACCG2802.460240752130744No Hit
GGGGTATCTAATCCCAGTTTGGGTCTTAGCTATTGTGTGTTCAGATATGT2662.337228714524207No Hit
GGGCGAGCAGTTTTGTTGATTTAACTGTTGAGGTTTAGGGCTAAGCATAG2632.310868992179949No Hit
GGGGATGCTTGCATGTGTAATCTTACTAAGAGCTAATAGAAAGGCTAGGA1841.616729637114489No Hit
GGGGAGCAGTTTTGTTGATTTAACTGTTGAGGTTTAGGGCTAAGCATAGT1791.5727967665407256No Hit
GGGGCTAAGCATAGTGGGGTATCTAATCCCAGTTTGGGTCTTAGCTATTG1611.414638432475178No Hit
GGGCAACTCCAGTCCCCACAACTCCCTTTTCTGGTACAGACAGACCATGA1541.3531324136719094No Hit
GGGCTAAGCATAGTGGGGTATCTAATCCCAGTTTGGGTCTTAGCTATTGT1261.107108338458835No Hit
GGGCTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACAT1251.0983217643440824No Hit
GGGGAGGGGGTGATCTAAAACACTCTTTACGCCGGCTTCTATTGACTTGG1171.028029171426061No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC970.8522976891310078No Hit
GGGGTGATCTAAAACACTCTTTACGCCGGCTTCTATTGACTTGGGTTAAT870.7644319479834812No Hit
GGGGTTTGTGGGGTTTTCTTCTAAGCCTTCTCCTATTTATGGGGGTTTAG820.720499077409718No Hit
GGGATGGCTGGGTCAAATGGTATTTCTAGTTCTAGATCCCTGAGGAATCG760.667779632721202No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC650.5711273174589228No Hit
GGGGAGTAAAATCTGATTTAACTGTGTTTTCTAAATAGCTAAGGGATGGA640.5623407433441702No Hit
GGGGTAGAAAATGTAGCCCATTTCTTGCCACCTCATGGGCTACACCTTGA640.5623407433441702No Hit
GGGTTGACAGTGAGGGTAATAATGACTTGTTGATTTAACTGTTGAGGTTT640.5623407433441702No Hit
GGGGAAACAGTTTGGAGAGAAATTAATTTGGCTTATTATCAGTCTCCTTC610.5359810209999121No Hit
CCCCATTCTCCTATTGCCTAAAATACTGGCAACCACTAATCTGCATTTGG610.5359810209999121No Hit
GGGCTAGTTTGAATAATTTCAGTGGGCTCTGGGGCATAGGAGCTGACCCT600.5271944468851595No Hit
GGGGTTTTAGTTAAATGTCCTTTGAAGTATACTTGAGGAGGGTGACGGGC600.5271944468851595No Hit
GGGGAAGCTAATCCAAAAGCTAGCAGAAGACAAGAAGTAATTAAGATCAG580.5096212986556542No Hit
GGGTGAGCCTCTGTCTGCGTGTGAGCCCGTGAGCCTGTGTGTGAGAGTGT570.5008347245409015No Hit
GGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCT570.5008347245409015No Hit
GGGTCTTAGCTATTGTGTGTTCAGATATGTTAAAGCCACTTTCGTAGTCT570.5008347245409015No Hit
GATACGGCGACCACCGAGATCTACACAAGGCTATGCCTGTCCGCGGAAGC540.47447500219664357Illumina Single End PCR Primer 1 (96% over 26bp)
GTGGGCTGTGGTGAGTGAGTGTGGGCTGTGAGTGTGGGCTGTGGTGAGTG510.4481152798523856No Hit
GGGGGAAATGCATGTGGGCCAACGATGGCTTCAGCAGGAGGCTTTCTTCT510.4481152798523856No Hit
GGGGGCTTCAATCGGGAGTACTACTCGATTGTCAACGTCAAGGAGTCGCA490.4305421316228802No Hit
GGGATTTTGGCGTAGGTTTGGTCTAGGGTGTAGCCTGAGAATAGGGGAAA480.42175555750812754No Hit
GGGGAGTGATTTTATATGATATATAAAATGAAAACTGCAAAAGGTATAGC450.3953958351638696No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGGACCTGAAAAACGTGTTC410.360249538704859No Hit
GGGGCGAGCAGTTTTGTTGATTTAACTGTTGAGGTTTAGGGCTAAGCATA400.3514629645901063No Hit
GGGGAATAATTGCAATCCCCGATCCCCATCACGAATGGGGTTCAACGGGT400.3514629645901063No Hit
GGTCGGAACTACGACGGTATCTGATCGTCTTCGAACCTCCGACTTTCGTT390.34267639047535364No Hit
GGGGAGAGCAGGGTGACTGCAGCCCCGGGGAAGGCAGGCGGCAGAGCGCA380.333889816360601No Hit
GGGACAGGGAGAAGTCCTTCCTCCTCAATTTCTTAGCATAGTTTTAGTAG380.333889816360601No Hit
GGGAGGGAATGTTTGCAATCTGTCCATCTGAAAAAGGCCTAATATCTAGA370.32510324224584836No Hit
GGGGAAACATCTTACCCTAGACAGAGAGCAGGCTTGCTGTGAAAGAGCTC370.32510324224584836No Hit
GGGATGCATCTGTGAGGGCTCACCCAGGCTGCCCATCTGGGAGAGATCAT370.32510324224584836No Hit
GGGAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAAT360.31631666813109566No Hit
GGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATC340.29874351990159037No Hit
GGGTACATCAGCTCCCGAAGGGTATGGCTGGTAAATGTGTTTGTCAGTGA340.29874351990159037No Hit
GATCATAATTCCATTCGATTCCATTCGATGATTCCATCTGATTCCATTCA340.29874351990159037No Hit
GGGAAGAAAGGAGAAAGGAGAGTTACAAGATGCCAACTCCACCATTACCC330.2899569457868377No Hit
GGGAGAAATACCAGTTTCCTGCCTGTAGCACTACTCAGATTTAGGATTTA330.2899569457868377No Hit
GGGGTCTCACAGTGACACTGATCTGGTAAAGCCCTCATCCTGTCCTGACC330.2899569457868377No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA320.2811703716720851No Hit
GGGGGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGT320.2811703716720851No Hit
GGGGACAGTGCTTTGGAGGAAAGGAAGAGATACTTGATAATATAGCTCTC310.27238379755733244No Hit
GGGGTTCAGTGGGGCTTGCCCTTACCAATGCATAAGGGTGTGTAGAACTA300.26359722344257974No Hit
GGGGACTAATACGCACAATGAGTTCTTAATGACTAGCATAGGGTAAAATA290.2548106493278271No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT290.2548106493278271No Hit
GGGGAGAGGATCTCCTCCCTCATCCATCTCTCTCTCTTCTGGGCAGGAGT280.24602407521307443No Hit
GGGGAGCTGCTGTGCAGCATGTATAAAGTTTCAGTTATGCGACATGAAAA280.24602407521307443No Hit
GGGGGGACTTGGGGAGGCAGGAGTGGAAGGCAGCAGGTCGCGGTTTTCCT270.23723750109832178No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG260.2284509269835691No Hit
GGGGGGTAAAGGGCAAGAAGAAAAGTGGAGAAGAAGGAAAAATGTTTAGC260.2284509269835691No Hit
GGGGGTTTATCGATTACAGAACAGGCTCCTCTAGAGGGATATGAAGCACC260.2284509269835691No Hit
GGGAGTATCACTGTGTCTTATAACACCGACAAGCTCATCTTTGGGACTGG260.2284509269835691No Hit
GGGGCAGTATTCAGTTTTAAGAAATCTATGGGTTTACTAAATCAAGCTCC250.21966435286881641No Hit
GGGATTACAGACATGGGTGCGTATTTCGTATCTCCTTGCCACTAGAATAT250.21966435286881641No Hit
GGGGACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG240.21087777875406377No Hit
GGGGGAATTAGACTGACAGGGAGCAAATAGGTAGCAAGGTTTTTCGTAAT240.21087777875406377No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC240.21087777875406377No Hit
GGGATGTGAAGCAAGCATGACACATCATCACCTTCTAGGCCCTGTGTCCA230.20209120463931113No Hit
GGGAAACAGAATGGCTTTTTGGCTGAGAAGGCTGGGTCTACATTTCAGGC230.20209120463931113No Hit
GGGGTAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTGGAGA220.19330463052455849No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT220.19330463052455849No Hit
GGGAAGGGGCAAATTCATAATCAGGAATTCCTGAGCCATCAGAAGCA220.19330463052455849No Hit
GGGGATCCTATGATGGGATTAGTATCTTTATGAGAAAAATTTGAGTCTCT220.19330463052455849No Hit
GGGAATTCCTCGTTCATGGGGAATAATTGCAATCCCCGATCCCCATCACG220.19330463052455849No Hit
GGCTTTCAGCACGCGCACACACACACACACACACACCCTACCATGGAAAC210.18451805640980581No Hit
GGGGATAATAATGTCACCTCTGCCTGCATCACTATAATATTCTACTGAAA200.17573148229505314No Hit
GGGCCTCAGAGTCTATTCTCTTTCCCTTGCTCTCCTACTCGGGCCCCCTT200.17573148229505314No Hit
GGGAATGGCTGCCTGCTGGAGCACCATGGGGGTGGTGTAGTGAGACATAG200.17573148229505314No Hit
GGGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATG200.17573148229505314No Hit
GGGGGACCTGGGGGATAGCTTCTAACCCCAACACCGATAAACTCATCTTT200.17573148229505314No Hit
GGGGTAAATATAAATTTGATTTTTATATACTCTGTAAGGCCGACAATACT200.17573148229505314No Hit
GGGAGGGAAACAATACCACAGTACTTACAGACATTAAAATGAGATTAAAT190.1669449081803005No Hit
GGGGTAATGTGACGAGGTTTTGTTCCGAAGCCCATGAGATCTTTGCAGTA190.1669449081803005No Hit
GGGAGACAGACTCGCTAGGGCCTGGCTCACCTGCCTCCCTCAACATCGGA180.15815833406554783No Hit
GGGATTGTCCTCTGTCTTTGGAGAGACAACATAGACATGATTCCAGGCTA180.15815833406554783No Hit
GGGGATGCCCCAACGTGACAACAGCTTGGAGAGGGGTGGGTACTGGAGAA180.15815833406554783No Hit
GGGGGATTTTCACCTTGACCCCTGTCACTGTGTGAACACTGAAGCTTTCT170.14937175995079519No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT170.14937175995079519No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA170.14937175995079519No Hit
GGGGTTGGGCAGGTTGGGCCCCGACAGCCCAGAAGGCTTTGGTAGTGGCA160.14058518583604254No Hit
GGGGAGCTCTCCATGCCCTGCCTTCCCCAGCACATGTACCCAGGGTGACA160.14058518583604254No Hit
GGGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGA160.14058518583604254No Hit
GGGGGAAAATTATTTGAATAAACATTGGTCAGTGGGGAGAAGTGAGTTTT160.14058518583604254No Hit
GGGGGCCCCAGTCTCATTCCAGACACCAGACCAACTTAGACTGTGCCCCA160.14058518583604254No Hit
GGGGGGAGAGTTCTGAGTGAGGGAGTGAACACCAGATGGAAAGTCAAGCA160.14058518583604254No Hit
GGGGGGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGG150.13179861172128987No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT140.12301203760653721No Hit
GGGGCCTTTTTCTCATGCTTGTAAGCTCCTTCATCTGGAAATGTGATTTA140.12301203760653721No Hit
GGGGAGCTTGGCCTCTGCTCCAGGACCCAAGGAGGTAGGGGCAAAGCCCA140.12301203760653721No Hit
GGGAAGTATGTGCCTGCGTTCAGGCGTTCTGGCTGGTTGCCTCATCGGGT130.11422546349178456No Hit
GGGCCCACAGTGACGTCTTATTTCCAAGGGGGATAGGCAGACTCAAATCA130.11422546349178456No Hit
GGGGCGTAACTCACACAGGCCCTCCAGCTCATGCAAGGAGAAGCAAGAGG130.11422546349178456No Hit
GGGGAAGTTTCTCGGGAGACTTAGGTGGTGAACGGTCCCGAGTTGGAGAG130.11422546349178456No Hit
GGGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCAC130.11422546349178456No Hit
GGGGAAGGGGAAGAGAGCATGGGACATTTGGTGGTCAGGGGAGACTGCCT130.11422546349178456No Hit
GGGGAGACTGACAGGGAGCAAATAGGTAGCAAGGTTTTTCGTAATGATGC120.10543888937703189No Hit
GGGGAGAAAGAAAGAGGTGGAAAATTCTTTCAAAGCAGAGATAATTTTGA120.10543888937703189No Hit
GGGAAGTAAAACTGTAAATGTTCTTAAGTGTGCATTTCTGCTGCTTCTGA120.10543888937703189No Hit
GGGAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAATAGAGCCAG120.10543888937703189No Hit

[OK]Adapter Content

Adapter graph