FastQCFastQC Report
Wed 8 May 2024
EGAF00004953540

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953540
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences68819
Total Bases13.3 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC50

[WARN]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT14972.175271364012845No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC9631.399322861419085No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA8561.243842543483631No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT8231.1958906697278366No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA5540.8050102442639386No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA5450.7919324605123585No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG5240.7614176317586713No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG5150.7483398480070911No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT5090.7396213255060377No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC4950.7192781063369127No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA4820.7003879742512968No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT4670.6785916679986631No Hit
GGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG4450.6466237521614671No Hit
GGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTC4300.6248274459088333No Hit
GGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT4280.6219212717418156No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA4090.5943126171551462No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT3970.5768755721530392No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT3940.5725163109025124No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT3890.5652508754849678No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC3600.5231113500632093No Hit
GGGAATACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCACAGAG3460.5027681308940846No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTC3400.49404960839303097No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG3330.4838779988084686No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC3320.48242491172495966No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG3300.47951873755794183No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC3250.47225330214039724No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT3240.4708002150568884No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT2750.39959894796495155No Hit
GGGGAAATCCACTGTGTTGTCCCCCAGCCAAGTGGATTCTCCTCTGCAAA2600.3778026417123178No Hit
GGGAACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA2590.37634955462880887No Hit
GGGAGCTCACTGTCCTCCATCCTAGCCAGGGCCCTCTCCCCTCTCTATGC2550.3705372062947732No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC2520.3661779450442465No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA2510.3647248579607376No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG2510.3647248579607376No Hit
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAAT2430.35310016129266625No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN2230.32403841962248797No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA2170.3153198971214345No Hit
GGGGACAACTCCCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGA2150.31241372295441666No Hit
GGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAG2120.30805446170388995No Hit
GGGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAG2090.3036952004533632No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC2090.3036952004533632No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA2050.29788285211932747No Hit
GGGGGTAATACCCATAAAGCACAGGAGGAGATTTCTTAGCTCACTGTCCT1990.28916432961827404No Hit
GGGGGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTGCT1980.2877112425347651No Hit
GGGAGAGGAGTTTATGTAAAGGGTTGGCCCAGAGTGTGTATTCAGGAGGA1970.2862581554512562No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT1810.26300876211511354No Hit
GGGAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAA1800.26155567503160465No Hit
GGGGGAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGTGCC1790.2601025879480957No Hit
GGGGACAACAATATGTTCTGGTATCGACAAGACCTGGGACATGGGCTGAG1760.255743326697569No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCC1760.255743326697569No Hit
GGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT1730.2513840654470423No Hit
GGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCACC1700.24702480419651549No Hit
GGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTT1690.2455717171130066No Hit
GGGGAGTCATCTCAGGTTTTGTTTTCCTGCTTTCCTCCCTAACCTCCACC1680.24411863002949766No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA1670.24266554294598874No Hit
GGGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTT1670.24266554294598874No Hit
GGGTGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAG1650.23975936877897092No Hit
GGGGAGCCTTAGAGGTTTGCATGCGGGATTGCACCTCCGTGCTCCTACGA1630.2368531946119531No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATTGAGGGGGGCAGGAGAGCAC1600.23249393336142637No Hit
GGGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTG1600.23249393336142637No Hit
GGGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC1590.23104084627791743No Hit
GGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAGC1590.23104084627791743No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG1570.2281346721108996No Hit
GGGAGCTGTGCTCCTATAATTCACCCCTCCACTTTGGGAACGGGACCAGG1560.2266815850273907No Hit
GGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGG1550.22522849794388175No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC1540.22377541086037286No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA1530.22232232377686392No Hit
GGGAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAA1520.22086923669335504No Hit
GGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCTT1510.21941614960984615No Hit
GGGGAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAA1480.21505688835931935No Hit
GGGAGAGACTCCCAGCCCAGTGATTCAGCCACCTACCTCTGTGCCGTGAA1460.21215071419230153No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGCAGCGGGACAGGCTTTC1460.21215071419230153No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG1430.2077914529417748No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT1430.2077914529417748No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA1410.20488527877475698No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT1390.20197910460773913No Hit
GGGAAACATTAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGAC1390.20197910460773913No Hit
GGGGGTTTTTTGGCAGTGGAACCCAGCTCTCTGTCTTGGAGGACCTGAAC1380.20052601752423024No Hit
GGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAA1380.20052601752423024No Hit
GGGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAG1360.19761984335721242No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT1310.19035440793966782No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT1310.19035440793966782No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC1300.1889013208561589No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA1280.18599514668914108No Hit
GGGAAACATCCTGAGGATGTTGCCTGGAGAGGACCTGAAAAACGTGTTCC1280.18599514668914108No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA1280.18599514668914108No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG1280.18599514668914108No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA1260.18308897252212325No Hit
GGGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAG1260.18308897252212325No Hit
GGGACTTCGGGCCGGGCACCAGGCTCACGGTCACAGAGGACCTGAAAAAC1240.18018279835510542No Hit
GGGGAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAACCAA1230.1787297112715965No Hit
GGGAGAGCATGTATTACTGTGACAATAACAATGACATGCGCTTTGGAGCA1220.1772766241880876No Hit
GGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTT1210.17582353710457868No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT1200.17437045002106977No Hit
GGGACACATCCCTCCAGCTAGGCAGGACAGGTAGAGAGTCCAGTGTCCTG1190.17291736293756085No Hit
GGGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTC1190.17291736293756085No Hit
GGGAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCC1180.17146427585405194No Hit
GGGCTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACAT1170.17001118877054303No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT1170.17001118877054303No Hit
GGGGAGATATAGCATCTGAGGACTGACTGTCTAGCTTAGACTGCTGTCTG1160.1685581016870341No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG1140.16565192752001628No Hit
GGGGACAGGAAGATGCATCTTGTAGGAGGCAGCTGTGAGGTCTGGTTCCC1130.16419884043650737No Hit
GGGGAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCT1110.16129266626948952No Hit
GGGAGACTGCTGTCTGCACAAGAAGAAGACTTACAGATGCTTAAGGAGGA1110.16129266626948952No Hit
GGGGACATTGTGCCCTCCCAGCCTGGAGACTCTGCAGTGTACTTCTGTGC1100.1598395791859806No Hit
GGGAGAGCACATCAAGAAGAGGGGTGAAGTGACAAAAGGGAGTTTATTGT1100.1598395791859806No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT1090.1583864921024717No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT1070.1554803179354539No Hit
GGGAGAGACTAACCTTTCAGTTTGGTGATGCAAGAAAGGACAGTTCTCTC1070.1554803179354539No Hit
GGGGGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCACAGGAG1050.15257414376843606No Hit
GGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG1040.15112105668492715No Hit
GGGGAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAA1030.1496679696014182No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA1010.14676179543440038No Hit
GGGATTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAACCTAACATTCT1000.14530870835089146No Hit
GGGAGCATTGTGCCGACAGAGGCTCAACCCTGGGGAGGCTATACTTTGGA980.14240253418387364No Hit
GGGAGTCATCCCTCCTCGCTGGTGAATGGAGGCAGTGGTCACAACTCTCC970.14094944710036472No Hit
GGGATTCCTGCTGTGATCCTGCCATGGATACCTGGCTCGTATGCTGGGCA970.14094944710036472No Hit
GGGAGGAGACACTGGTGACAGGTGTCTGCCCTGTTTCTGTAAAGCTGCTG960.1394963600168558No Hit
GGGGGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAGGACCTGAAA960.1394963600168558No Hit
GGGGAGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCT960.1394963600168558No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG950.1380432729333469No Hit
GGGGGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCTGCCATGGGCC930.13513709876632907No Hit
GGGAGGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCT930.13513709876632907No Hit
GGGGAGTGAGGGAGTGAACACCAGATGGAAAGTCAAGCAACAGGTTTCTG930.13513709876632907No Hit
GGGAGAAGCTGACTGGATATTCTGGCAGGCCAAGGATGGAGACTCTCCTG930.13513709876632907No Hit
GGGGAGGGACGATACAACATGACCTATGAACGGTTCTCTTCATCGCTGCT920.13368401168282015No Hit
GGGTGGGCGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTC920.13368401168282015No Hit
GGGGGAGGAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGT920.13368401168282015No Hit
GGGGAGTGTAGTGACTAACCCTCCTACTTTTGGTGTTGTGTTTCTGCCTA920.13368401168282015No Hit
GGGATATTCCGAAATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCAG920.13368401168282015No Hit
GGGGGATACTCTTACTGCTTGGAAGAACCCGTGGAGATTCAGTGACCCAG910.13223092459931124No Hit
GGGACTTTCGGGGCCGGCAGCAGGCTGACCGTGCTGGAGGACCTGAAAAA910.13223092459931124No Hit
GGGGGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTCCCTGAG910.13223092459931124No Hit
GGGGATTTCCTCCTCACTCTGGAGTCCGCTACCAGCTCCCAGACATCTGT910.13223092459931124No Hit
GGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGA890.1293247504322934No Hit
GGGAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAAC890.1293247504322934No Hit
GGGGAGTTTGACGCTGTGTGGAATATGGAAACAAGCTGGTCTTTGGCGCA880.1278716633487845No Hit
GGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGG880.1278716633487845No Hit
GGGGACATTTCCTCTTCCCAGACCACAGACTCAGGCGTTTATTTCTGTGC880.1278716633487845No Hit
GGGGAGAATGGCCTCTCTGGCAATCGCTGAAGACAGAAAGTCCAGTACCT880.1278716633487845No Hit
GGGAGTCTCGGGATGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTT870.12641857626527558No Hit
GGGAAGCACAGAGGAGAACCCATCAGAGCAGGAGACTTTTCACTCTGCAG870.12641857626527558No Hit
GGGGAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCT860.12496548918176666No Hit
GGGGGAGGCTGATCCATTACTCATATGGTGTTCACGACACTAACAAAGGA860.12496548918176666No Hit
GGGGGGGCAGCCCCTTCCCACTGTGCTCCTACAATGAGCAGTTCTTCGGG860.12496548918176666No Hit
GGGACGCAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCT850.12351240209825774No Hit
GGGGGACGCTGTGTGGAATATGGAAACAAGCTGGTCTTTGGCGCAGGAAC850.12351240209825774No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT840.12205931501474883No Hit
GGGGGTTGTTTGTGGTGTTGAGATGCCCAGGCTGGAGGGAGGAAGCTCTA840.12205931501474883No Hit
GGGAGTTTGGAGAAGCAAAAAAGAACAGCTCCCTGCACATCACAGCCACC840.12205931501474883No Hit
GGGGAAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG830.12060622793123991No Hit
GGGAGAAGGATGTGGAGAGAGGCAGATCTTTTTAGTCTAATGAGGCTTAG830.12060622793123991No Hit
GGGGAGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTG830.12060622793123991No Hit
GGGGGAAACCCTCTGTGCATTGGAGTGATGCTGCTGAGTACTTCTGTGCT830.12060622793123991No Hit
GGGAGAAGTAGACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCA820.11915314084773101No Hit
GGGAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCT820.11915314084773101No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA810.1177000537642221No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG810.1177000537642221No Hit
GGGAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAG800.11624696668071319No Hit
GGGACAACAAGTGTGAAGAACCCTACTATGGTTTTTTGCCCAATGCCCTC800.11624696668071319No Hit
GGGGAGTCCGCTACCAGCTCCCAGACATCTGTGTACTTCTGTGCCATCAG800.11624696668071319No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC800.11624696668071319No Hit
GGGGATTTTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTA800.11624696668071319No Hit
GGGGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCAGACTC800.11624696668071319No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT800.11624696668071319No Hit
GGGATATCTGTCAACGTGGAACCTCCCTGACGATCCAGTGTCAAGTCGAT800.11624696668071319No Hit
GGGGGTTTTTGTCCTGGGCCTCCAGGCTGTGAGCACAGATACGCAGTATT790.11479387959720426No Hit
GGGGGCATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGC790.11479387959720426No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA790.11479387959720426No Hit
GGGAGCGTTTGAAGGAAAACTGTGAGGAAGAAGGGACACTCCATGGTGTT780.11334079251369535No Hit
GGGGAACACTGTGTATCTAACTTTGGAAATGAGAAATTAACCTTTGGGAC780.11334079251369535No Hit
GGGGAAGACTGACTGCTCAGTTTGGTATAACCAGAAAGGACAGCTTCCTG780.11334079251369535No Hit
GGGAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCTGTGAGTGCCT780.11334079251369535No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGTGGTGAACATTATGTAACAATG780.11334079251369535No Hit
GGGGTAGAGCAGACTGTGGCTTTACCCCTTGTGTTTGAGCCATCAGAAGC780.11334079251369535No Hit
GGGAGTCATCTCAGGTTTTGTTTTCCTGCTTTCCTCCCTAACCTCCACCT780.11334079251369535No Hit
GGGGACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG780.11334079251369535No Hit
GGGGAGGACTCCTGGTTCTGGGTGCTGGGAGAGCGATGGGGCTCTCAGCG770.11188770543018643No Hit
GGGGGAGAAAGGCTCAGTTCAAGTGTCAGACTCAGCGGTGTACTTCTGTG770.11188770543018643No Hit
GGGGAGAGCAGGAGGCAGAGACTGTGACCCTGAGTTGCACATATGACACC760.11043461834667752No Hit
GGGCAGACAGACTTGTCACGACTTCATATTCTCCCCAATATCCAGAACCC760.11043461834667752No Hit
GGGGAGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGTG750.1089815312631686No Hit
GGGATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAAC750.1089815312631686No Hit
GGGGTAGAGCAGACTGTGGCTTTACCTCGGTGTCCTACCAGCAAGGGGTC750.1089815312631686No Hit
GGGACGCTACGCTGAGAGACACTGCTGTGTACTATTGCATCGTCAGACCC750.1089815312631686No Hit
GGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTT740.10752844417965968No Hit
GGGGGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTTGGG730.10607535709615076No Hit
GGGGATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCACAGCTCAAT720.10462227001264185No Hit
GGGGGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGGTTTACAGCA720.10462227001264185No Hit
GGGGAGTTTGGAGAAGCAAAAAAGAACAGCTCCCTGCACATCACAGCCAC720.10462227001264185No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGTGGTGAGAGACAATAACAATGA720.10462227001264185No Hit
GGGGAAAATTGCAGCTACTCAACCTGGAGACTCAGCTGTCTACTTTTGTG710.10316918292913294No Hit
GGGGATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAAC710.10316918292913294No Hit
GGGGATATTCAGTCCAGGTATCAGACTCAGCCGTGTACTACTGTCTTCTG710.10316918292913294No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA710.10316918292913294No Hit
GGGGAGAGGGGAAGGTGATCTCACTTGCTCAGCCTTCCCCTCCATCCTTC710.10316918292913294No Hit
GGGGAGAACACAAAGTCGAACGGAAGATATACAGCAACTCTGGATGCAGA700.10171609584562402No Hit
GGGAGAAAAGAATGATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGG700.10171609584562402No Hit
GGGACAAACGAAGTGGCCTCCCTGTTTATCCCTGCCGACAGAAAGTCCAG700.10171609584562402No Hit
GGGTGGGAAACACCTCCATCCTGCCTCTTCATGCCATGGCCTCCCTGCTC700.10171609584562402No Hit
GGGGAGTGTAAATACCGGCACTGCCAGTAAACTCACCTTTGGGACTGGAA700.10171609584562402No Hit
GGGGGGAAACCCTCTGTGCATTGGAGTGATGCTGCTGAGTACTTCTGTGC690.10026300876211512No Hit
GGGAAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTGC690.10026300876211512No Hit
GGGAGACTCCCAGCCATCAGGTCACACAGATGGGACAGGAAGTGATCTTG690.10026300876211512No Hit
GGGGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCTG690.10026300876211512No Hit
GGGATCAAAGGATCCCAGCCTGAAGACTCAGCCACATACCTCTGTGCCTC690.10026300876211512No Hit
GGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGAG690.10026300876211512No Hit

[OK]Adapter Content

Adapter graph