FastQCFastQC Report
Wed 8 May 2024
EGAF00004953552

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953552
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences175806
Total Bases32.8 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC50

[WARN]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC2380613.541062307316018No Hit
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAAT28451.6182610377347757No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA21941.24796650853782No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN16140.9180574041841576No Hit
GGGGTGACTTCCCTGGTCACCAAGGCAGTGCATGCATGTTGGGGTTTCCT13280.7553780872097653No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA11540.6564053559036666No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT10890.619432783864032No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG10850.6171575486615929No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA10800.6143135046585441No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT10750.6114694606554952No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA10010.5693776094103727No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT9770.5557261981957385No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT9510.5409371693798846No Hit
GGGATGCCCCAACGTGACAACAGCTTGGAGAGGGGTGGGTACTGGAGAAG9260.5267169493646405No Hit
GGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGACTGAGAAGGCTCACGAA8970.5102214941469574No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT8480.4823498629170791No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC8380.4766617749109814No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG7400.4209185124512247No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA7130.40556067483476105No Hit
GGGAGAAATGTGTTCAGGCAGACTGGATGTGTTTTTGACAGGATATGTAA7090.403285439632322No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT6780.38565236681341936No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG6650.3782578524054924No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC6350.3611935883871995No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA6350.3611935883871995No Hit
GGGGAAGCAAGACGTCCTGGAATGAAGCATGTAGCTCTATGGGGGGAGGG5570.316826501939638No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA5440.3094319875317111No Hit
GGGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGCA5240.2980558115195158No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT5190.295211767516467No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA5090.2895236795103694No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT5080.2889548707097596No Hit
GGGAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAAC5010.2849732091054913No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT4970.28269797390305224No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG4930.2804227387006132No Hit
GGGAGGACAGTTCTCTCCACATCACTGCAGCCCAGCCTGGTGATACAGGC4900.27871631229878385No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA4840.2753034594951253No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA4670.2656337098847593No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA4660.2650649010841496No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC4550.2588080042774422No Hit
GGGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACG4240.24117493145853955No Hit
GGGAGTGGAGTGTGTGGTGGGGCCCCAAGAGTTCTGTGTGTAAGCAGCTT4160.23662446105366142No Hit
GGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTG4150.23605565225305164No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA4150.23605565225305164No Hit
GGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATA3840.218422579434149No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT3810.21671615303231972No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA3710.21102806502622207No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA3590.2042023594189049No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG3510.19965188901402683No Hit
GGGAGATGTTCCTGAGCTGACCTCAGTCAGAGGTGCGTGGCTCCAGCACC3450.19623903621036826No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA3440.19567022740975848No Hit
GGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAGC3440.19567022740975848No Hit
GGGACTACGCTCACTGTGAAGCCAAATATCCAGAACCCTGACCCTGCCGT3430.1951014186091487No Hit
GGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTA3420.19453260980853898No Hit
GGGATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCT3370.19168856580549015No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC3290.18713809540061205No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT3190.1814500073945144No Hit
GGGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAA3190.1814500073945144No Hit
GGGATTCAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTT3180.18088119859390464No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGGTCTGGGCGGCACTG3150.17917477219207537No Hit
GGGCTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACAT3130.17803715459085584No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGCCGTGAACATCCTCCGTCTTAA3120.17746834579024606No Hit
GGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGAG3100.17633072818902654No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG3040.17291787538536796No Hit
GGGAGTAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGG3010.17121144898353868No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA2970.1689362137810996No Hit
GGGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGT2910.16552336097744105No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG2860.16267931697439222No Hit
GGGGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTG2840.1615416993731727No Hit
GGGAGGATATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATC2840.1615416993731727No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA2820.16040408177195317No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA2790.1586976553701239No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG2720.15471599376585554No Hit
GGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT2700.15357837616463602No Hit
GGGAAAAACTCTGTGCATACTCTGGGGCTGGGAGTTACCAACTCACTTTC2630.1495967145603677No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGTGGTGAACGAACTGGGGAGCTA2610.14845909695914816No Hit
GGGGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGC2610.14845909695914816No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT2570.1461838617567091No Hit
GGGAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCTGTCCTTCTCA2570.1461838617567091No Hit
GGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAGG2560.14561505295609933No Hit
GGGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGC2550.14504624415548958No Hit
GGGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAG2550.14504624415548958No Hit
GGGGTTTCCTTTACCTTTTCTATAAGTTGTACCAAACCATCCG2510.14277100895305053No Hit
GGGAGGAGGGTAAGGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGAC2510.14277100895305053No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG2470.14049577375061145No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA2470.14049577375061145No Hit
GGGGGAGAAGTGAAGAAGCTGAAGAGACTAACCTTTCAGTTTGGTGATGC2450.13935815614939193No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCAGCCCCTTCGCCAAAC2440.13878934734878218No Hit
GGGAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGAAGGAGAAGGAAATG2390.13594530334573338No Hit
GGGGGAAAAGGGACACGACTTCATATTCTCCCCAAGGCCTGAGTCAAGGT2390.13594530334573338No Hit
GGGGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAACA2380.1353764945451236No Hit
GGGGAAGGAAAACTGTGAGGAAGAAGGGACACTCCATGGTGTTGTTGTTG2380.1353764945451236No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGTCGCCCGGGGGG2360.13423887694390407No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT2360.13423887694390407No Hit
GGGGAGCCTTCCCCTCCATCCTTCCCACCTGTTGATTATTGTAAAGCCCC2350.13367006814329432No Hit
GGGAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAG2340.13310125934268455No Hit
GGGAGTTACCAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTCATACC2330.1325324505420748No Hit
GGGAAGAAGAAGCATGGAAGATTAATTGCCACAATAAACATACAGGAAAA2330.1325324505420748No Hit
GGGGGAGATGCCCAGGCTGGAGGGAGGAAGCTCTAGGGGGTTTTTGCTGA2320.13196364174146502No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT2310.13139483294085527No Hit
GGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG2280.12968840653902597No Hit
GGGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAATC2280.12968840653902597No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG2270.12911959773841622No Hit
GGGGATACTCTTACTGCTTGGAAGAACCCGTGGAGATTCAGTGACCCAGA2220.1262755537353674No Hit
GGGGAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAA2210.1257067449347576No Hit
GGGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTT2200.12513793613414786No Hit
GGGAGGATAAACATCTGTCTCTGCGCATTGCAGACACCCAGACTGGGGAC2200.12513793613414786No Hit
GGGGAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC2190.1245691273335381No Hit
GGGCAGAGAAACAAAGGAAACTTCCCTGGTCGATTCTCAGGGCGCCAGTT2170.12343150973231856No Hit
GGGACCAAACTCTCGGTCATACCAAATATCCAGAACCCTGACCCTGCCGT2150.12229389213109906No Hit
GGGGTAGAGCAGACTGTGGCACCAGGCTCACGGTCACAGAGGACCTGAAA2150.12229389213109906No Hit
GGGGGAACATCACAGCCACCCAGACCGGAGACTCGGCCGTCTACCTCTGT2140.1217250833304893No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGCAACCTGGCGAAATACTGGAGG2130.12115627452987954No Hit
GGGAACAACAGAAGGTCGCTACTCATTGAATTTCCAGAAGGCAAGAAAAT2110.12001865692866001No Hit
GGGACAAACGAAGTGGCCTCCCTGTTTATCCCTGCCGACAGAAAGTCCAG2100.11944984812805025No Hit
GGGAAGGAAGCACTGCCAGCTCTTTATTCAGTGCTTTGCCAACCTGGCCT2090.11888103932744049No Hit
GGGTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC2080.11831223052683071No Hit
GGGAAGGACTCCAGCTTCTCCTGAAGTACACATCAGCGGCCACCCTGGTT2070.11774342172622095No Hit
GGGGAGTTACCAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTCATAC2040.11603699532439166No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG2040.11603699532439166No Hit
GGGAGGAAACCCTCTGTGCATTGGAGTGATGCTGCTGAGTACTTCTGTGC2040.11603699532439166No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC1980.11262414252073308No Hit
GGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG1970.11205533372012332No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC1970.11205533372012332No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC1940.11034890731829403No Hit
GGGAGCCCCGCCCTTGTCCATCACTGGCATCTGGACTCCAGCCTGGGTTG1930.10978009851768426No Hit
GGGAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCACGCTCGA1930.10978009851768426No Hit
GGGGAAACAGAGGCTGCAAGGTGGGGAGACTTCCACTAGAGGGGAAGGTG1920.1092112897170745No Hit
GGGAGAGACTAACCTTTCAGTTTGGTGATGCAAGAAAGGACAGTTCTCTC1900.10807367211585499No Hit
GGGATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTAT1900.10807367211585499No Hit
GGGAACTCAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGAC1890.10750486331524522No Hit
GGGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGC1870.1063672457140257No Hit
GGGACACTTCCCCCTGACCTTTGCACAGATGCTGAGGTCTGAGGTTTCTG1860.10579843691341594No Hit
GGGAAGCGAAAGGCCAAGGACCCCCCTCGGTCTCCGCCGGATTCTGAGTC1830.10409201051158665No Hit
GGGGAAAGCTGCTGACAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCTGA1830.10409201051158665No Hit
GGGGGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCACAGGAG1820.10352320171097687No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAACCATCCG1790.10181677530914758No Hit
GGGGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCT1780.10124796650853782No Hit
GGGAGACAGGTTGGTGAGGAGACACTGGTGACAGGTGTCTGCCCTGTTTC1780.10124796650853782No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGGTAATGGGTCCTACAATG1770.10067915770792805No Hit
GGGGACGGCTCACCGTGCTAGAGGACCTGAAAAACGTGTTCCCACCCGAG1770.10067915770792805No Hit
GGGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAG1760.10011034890731829No Hit

[OK]Adapter Content

Adapter graph