FastQCFastQC Report
Wed 8 May 2024
EGAF00004953568

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953568
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences154093
Total Bases33.6 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA31052.0150169053753255No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC25821.6756114813781289No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT14810.9611079023706464No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT14140.9176276664092464No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGGTCGCTGTGTTTGAGCCA10750.6976306516194766No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG10730.6963327341280915No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC10180.660640003115002No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT9850.6392243645071483No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG9190.5963930872914409No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC8810.5717326549551245No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA8540.554210768821426No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC8460.5490190988558857No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT8390.544476387636038No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC8180.5308482539764947No Hit
GGGGAGAACTGGCAGACACCTGCCTGATGCTGCCATGGGCCCCCAGCTCC7860.5100815741143336No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA7750.5029430279117156No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT7350.4769846780840142No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT7030.456217998221853No Hit
GGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGC6940.4503773695106202No Hit
GGGGAAAGTATCTCTGCTATGTTCATTTCTTTTTGGATTGAAAATTTTAA6810.44194090581661727No Hit
GGGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTA6710.43545131835969186No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT6630.4302596483941516No Hit
GGGACAGTGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCC6420.41663151473460835No Hit
GGGTACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA6330.41079088602337555No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT6330.41079088602337555No Hit
GGGAAAAAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAAC6270.4068971335492203No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA5930.38483253619567404No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT5910.38353461870428895No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA5870.38093878372151885No Hit
GGGAGTGTGCCCAGGATATGAACCATGAATACATGTCCTGGTATCGACAA5810.3770450312473636No Hit
GGGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACG5760.3738002375189009No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT5650.366661691316283No Hit
GGGGAGGTCAATGACTGATCTTAATTGGGAAGAACAAGGATGACATCCAT5640.36601273257059047No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCG5570.36147002135074274No Hit
GGGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGA5520.35822522762228004No Hit
GGGGATTGTGGGGACTAGCGGGGGTACGGGAGGGAGCAGTTCTTCGGGCC5480.3556293926395099No Hit
GGGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAA5110.33161791904888605No Hit
GGGGTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACA5030.3264262490833458No Hit
GGGAGGGACACGGCTCACCGTGCTAGAGGACCTGAAAAACGTGTTCCCAC5020.32577729033765324No Hit
GGGGGAGAAAAGAAGGTTGGAATTATCGTAATTTGTTTCTAGGCTGAGAT4840.31409603291518756No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC4830.3134470741694951No Hit
GGGACAGTGTAAATACCGGCACTGCCAGTAAACTCACCTTTGGGACTGGA4780.3102022804410324No Hit
GGGGGAGACGTTACAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACC4750.30825540420395475No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA4750.30825540420395475No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT4710.3056595692211846No Hit
GGGGAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTGTCA4690.30436165172979956No Hit
GGGAGAAAAGAATGATGAAATCCTTGAGAGTTTTACTGGTGATCCTGTGG4660.30241477549272194No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG4630.3004678992556443No Hit
GGGAAACATTAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGAC4490.2913824768159488No Hit
GGGGGCCACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGG4460.2894356005788712No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT4400.285541848104716No Hit
GGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCT4400.285541848104716No Hit
GGGGGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCT4340.28164809563056076No Hit
GGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGATT4310.27970121939348314No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA4200.27256267319086525No Hit
GGGGCTTTCTGCTTTCTTGACATCCGCTCACCAGGCCTGGGGGACGCAGC4050.2628282920054772No Hit
GGGGATAAAGCACAGGAGGAGATTTCTTAGCTCACTGTCCTCCATCCTAG3990.258934539531322No Hit
GGGGAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACCCGTGGA3930.2550407870571668No Hit
GGGAGAGGAAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTG3930.2550407870571668No Hit
GGGGAATAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTG3910.2537428695657817No Hit
GGGAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTCTGCTGTGCGGTTCT3900.25309391082008914No Hit
GGGAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTCTAG3880.2517959933287041No Hit
GGGGAGGCTTTGTCGGGTGGAGCTGATTGGTTGCAGGAGCAGCAACAGTT3810.24725328210885633No Hit
GGGGAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAAC3810.24725328210885633No Hit
GGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGAT3800.24660432336316382No Hit
GGGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGC3700.24011473590623847No Hit
GGGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTT3690.2394657771605459No Hit
GGGAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCT3690.2394657771605459No Hit
GGGAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAACC3670.23816785966916085No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT3650.23686994217777574No Hit
GGGGAGTCTGCACCTTTCATTCACAGCAGTAACACTGTTCTCCTTAACTC3600.23362514844931306No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC3580.232327230957928No Hit
GGGGAGGAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGTG3570.23167827221223547No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGA3560.2310293134665429No Hit
GGGGGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTAT3550.2303803547208504No Hit
GGGGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCT3530.22908243722946534No Hit
GGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGAG3520.2284334784837728No Hit
GGGGGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATGGGACTCGAC3500.22713556099238771No Hit
GGGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATT3490.22648660224669517No Hit
GGGGGAAGAACCCTACTATGGTTTTTTGCCCAATGCCCTCCACAAAGCCA3480.22583764350100266No Hit
GGGAGTGAATCACGTTTTGCCCAGGAAAACACACTTGATAACTGAAGGAT3470.2251886847553101No Hit
GGGAGTGAACACCAGATGGAAAGTCAAGCAACAGGTTTCTGTTATGAAGC3460.22453972600961755No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT3420.22194389102684742No Hit
GGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCACC3380.21934805604407726No Hit
GGGGAGTCACTGCATGTTCAGGAGGGAGACAGCACCAATTTCACCTGCAG3340.21675222106130715No Hit
GGGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTT3330.21610326231561458No Hit
GGGAGTTCTATTTTGGGACAGGGACAAGTTTGACGGTCATTCCAAGTATA3330.21610326231561458No Hit
GGGGAAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTGGAGA3320.21545430356992207No Hit
GGGGGTATCATGGTGTAACATTGTGGGGACTAGCGTTCGTACAATGAGCA3310.21480534482422953No Hit
GGGGGACTCAGCCACCTACCTCTGTGCTGTATCAGGAAACACACCTCTTG3310.21480534482422953No Hit
GGGATTGGGAACAAGCCTGGCAGTAAATCCGAATATCCAGAACCCTGACC3290.21350742733284445No Hit
GGGAGAAACACTGTGGGGATAACTATGGTCAGAATTTTGTCTTTGGTCCC3290.21350742733284445No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC3280.2128584685871519No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCAC3280.2128584685871519No Hit
GGGGAACCAAGGACTCCAGCTTCTCCTGAAGTACACATCAGCGGCCACCC3270.2122095098414594No Hit
GGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTC3260.21156055109576685No Hit
GGGGGGAATATGAAGGCTGCAGCGATGCCTGCAAGTCAGCTTTTGCTACA3240.21026263360438174No Hit
GGGGAAGAAGAGTGAAACCTCCTTCCACCTGACGAAACCCTCAGCCCATA3220.20896471611299672No Hit
GGGACATACCTCTGTGCCTTTCTGAACGACTACAAGCTCAGCTTTGGAGC3170.20571992238453402No Hit
GGGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAAC3170.20571992238453402No Hit
GGGAAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATC3170.20571992238453402No Hit
GGGGACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCA3150.20442200489314893No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA3150.20442200489314893No Hit
GGGGGGGAGAGATGAGATCCTGGCCTGGACCTGAAATGGGCACAAGGTTG3130.20312408740176388No Hit
GGGGACTTTCGGGAAGGGGACCAAACTCTCGGTCATACCAAAGGCCTGAG3110.20182616991037877No Hit
GGGGAGGGAGGAAGCTCTAGGGGGTTTTTGCTGAGCCCAGAAACACTGTG3080.1998792936733012No Hit
GGGGAGCCCAGAGAAGTCTGTTCCAGGACGGGCTCTTTCAGGAGCAGCTA3080.1998792936733012No Hit
GGGGACAGGAGGGATGGCCATGCTCCTGGGGGCATCAGTGCTGATTCTGT3060.1985813761819161No Hit
GGGGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACC3020.19598554119914596No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN3020.19598554119914596No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG2970.1927407474706833No Hit
GGGGATGGCTGGAGATTGCAGGTTTATGACTGATCCTATTTGGGAAGAAC2960.19209178872499075No Hit
GGGGAGGCTAACTATGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGT2950.19144282997929823No Hit
GGGGAGGGCATGAGTTTTTCTGGCAGAGGAGTTTATGTAAAGGGTTGGCC2940.19079387123360567No Hit
GGGAATGTTCTGGATGGTTTGGAGGAGAAAGGTCGTTTTTCTTCATTCCT2940.19079387123360567No Hit
GGGGATTCAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGT2930.19014491248791315No Hit
GGGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA2930.19014491248791315No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA2930.19014491248791315No Hit
GGGGATATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTT2910.18884699499652807No Hit
GGGAGTGATTCAGCCACCTACCTCTGTGTGGTGATTCTAAATACTGGAGG2900.18819803625083553No Hit
GGGATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCT2900.18819803625083553No Hit
GGGGAGAGATGAGATCCTGGCCTGGACCTGAAATGGGCACAAGGTTGTTC2880.18690011875945045No Hit
GGGGAAACACTGTGATACTCACGGGAGGAGGAAACAAACTCACCTTTGGG2830.18365532503098778No Hit
GGGGATCTCTGATACTCTTACTGCTTGGAAGAACCCGTGGAGATTCAGTG2820.18300636628529524No Hit
GGGAATAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAA2820.18300636628529524No Hit
GGGGAGAGCAGCTGTGGAGGTTACGGGAGGTTCAGGGCATGAGTTTTTCT2790.18105949004821761No Hit
GGGGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGC2780.1804105313025251No Hit
GGGGGAAATGGCCCATTTTGTCGCAGTGCAAATCACTGTGGGAAATACTG2770.17976157255683256No Hit
GGGAGAATTCCGAGGCCCTGAACATTCAGGAGGGTAAAACGGCCACCCTG2750.1784636550654475No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA2730.17716573757406243No Hit
GGGGGGGGAGTTACCAACTCACTTTCGGGAAGGGGACCAAACTCTCGGTC2720.17651677882836989No Hit
GGGGATTTCTGTGCTGCGGGAGGCCCGGAGGAGGTGCTGACGGACTCACC2710.17586782008267735No Hit
GGGAGCCCAGAGAAGTCTGTTCCAGGACGGGCTCTTTCAGGAGCAGCTAA2700.1752188613369848No Hit
GGGAGAAATGTTTGAACGTATGAGATAGCAAAGCAGAGTGTTTATTTTGT2700.1752188613369848No Hit
GGGGAAGAAACCATTTGCTCAAGAGGAAGACTCAGCCATGTATTACTGTG2700.1752188613369848No Hit
GGGAGAAATCCACCAGTTCCTTCAACTTCACCATCACAGCCTCACAAGTC2690.17456990259129226No Hit
GGGGAGTGCTTTTCAATACTTCATGTGGTACAGACAGTATTCCAGAAAAG2690.17456990259129226No Hit
GGGGACAGCCACCCAGACTACAGATGTAGGAACCTACTTCTGTGCAGGGG2690.17456990259129226No Hit
GGGGGTAGAGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTT2680.17392094384559975No Hit
GGGATGACAAATAAGAAGTCTTTGAAATGTGAACAACATATGGGGCACAG2670.17327198509990718No Hit
GGGGAGCTTGGAGCGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA2660.17262302635421467No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT2660.17262302635421467No Hit
GGGGAGTGGCTCAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCCTG2660.17262302635421467No Hit
GGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAACA2650.17197406760852213No Hit
GGGGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGT2640.1713251088628296No Hit
GGGGATCATCACAGAAGACAGAAAGTCCAGCACCTTGATCCTGCCCCACG2600.16872927388005945No Hit
GGGAGAGGCCGGGGATACTGGAGGCTTCAAAACTATCTTTGGAGCAGGAA2590.16808031513436691No Hit
GGGGGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGGCCACACAGAT2570.16678239764298183No Hit
GGGGATTCAGCCACCTACCTCTGTGTGGTGAACATCGAATTATGGAGGAA2570.16678239764298183No Hit
GGGATTTTGTAAAGGCAGGCATTACAGTGTGAATTCTGGGGGTTACCAGA2570.16678239764298183No Hit
GGGATTCAAGGATACAAGACAAAAGTTACAAACGAAGTGGCCTCCCTGTT2570.16678239764298183No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG2540.1648355214059042No Hit
GGGATTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAACCTAACATTCT2520.16353760391451916No Hit
GGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTT2500.16223968642313408No Hit
GGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAATCA2500.16223968642313408No Hit
GGGGTAGGGCGCTCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCAC2480.16094176893174902No Hit
GGGGATGTGAGTCTTGAGAGTTTCTGACTCTTCCATAGCGAATTCTAAAG2470.16029281018605646No Hit
GGGGGGTTTTTTGCCCAATGCCCTCCACAAAGCCAGCGTTTGAAGGAAAA2450.1589948926946714No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT2450.1589948926946714No Hit
GGGGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCAC2440.15834593394897886No Hit
GGGCACTGTGATACTCACGGGAGGAGGAAACAAACTCACCTTTGGGACAG2420.15704801645759378No Hit
GGGAAACAGAATGGCTTTTTGGCTGAGAAGGCTGGGTCTACATTTTAGGC2420.15704801645759378No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGG2420.15704801645759378No Hit
GGGTGAGGGAAATGGAAATGAGCAAAGAGCAGGCTGACTCCAGGACGTTT2400.15575009896620873No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG2390.1551011402205162No Hit
GGGGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTG2390.1551011402205162No Hit
GGGGGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTG2380.15445218147482365No Hit
GGGGACAGTGTAAATACCGGCACTGCCAGTAAACTCACCTTTGGGACTGG2380.15445218147482365No Hit
GGGGAGGATATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTAT2370.1538032227291311No Hit
GGGACACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC2360.15315426398343857No Hit
GGGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCA2350.15250530523774605No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT2340.15185634649205348No Hit
GGGAGTATGGTGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTA2320.15055842900066843No Hit
GGGAGTGAGAGCAATGTAAAACAATAGAAAGCAACAGTTCAGAGCACTGC2320.15055842900066843No Hit
GGGCAGCAGGTCGCGGTTTTCCTTCCAGTCTTTAATGTTGTGCAACTAAT2310.1499094702549759No Hit
GGGAAAAAAAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAA2300.14926051150928335No Hit
GGGGTGACTGAGGAGCCTTGCTCCATTTCAGGTCTTCTGTGATTTCAATA2280.1479625940178983No Hit
GGGGGGCAGAGGAGTTTATGTAAAGGGTTGGCCCAGAGTGTGTATTCAGG2280.1479625940178983No Hit
GGGGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTG2260.14666467652651322No Hit
GGGTGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG2260.14666467652651322No Hit
GGGAAAAAAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAA2260.14666467652651322No Hit
GGGGACTGTTCTATTGAATAAAAAGGATAAACATCTGTCTCTGCGCATTG2240.14536675903512813No Hit
GGGGGTAAAGCCCTCATCCTGTCCTGACCCTGCCATGGGCACCAGTCTCC2220.14406884154374305No Hit
GGGGATGGGAACAACAGACTCGCTTTTGGGAAGGGGAACCAAGTGGTGGT2220.14406884154374305No Hit
GGGAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGC2210.14341988279805054No Hit
GGGCAACTCCAGTCCCCACAACTCCCTTTTCTGGTACAGACAGACCATGA2200.142770924052358No Hit
GGGGAAGACAAAAGTTACAAACGAAGTGGCCTCCCTGTTTATCCCTGCCG2200.142770924052358No Hit
GGGGAGTTAGAGAGAAAGAAAAATGTATCATCAAACCATAGAATAGGCTG2180.14147300656097292No Hit
GGGAAACTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAATCTAACATT2180.14147300656097292No Hit
GGGAGTCATCCCTCCTCGCTGGTGAATGGAGGCAGTGGTCACAACTCTCC2170.14082404781528038No Hit
GGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT2170.14082404781528038No Hit
GGGGGCAGAAACACTGTGTCAAACTGGGGCAAACAACCTCTTCTTTGGGA2160.14017508906958784No Hit
GGGATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACC2140.13887717157820276No Hit
GGGGAGAGCATCATTTTTTTGAACTGGTAAAGCAGATTCTTTTTATGATT2110.13693029534112516No Hit
GGGGAATCCTCAGTGAACCAGGGCAGAGAAGAATGATGAAATCCTTGAGA2100.13628133659543262No Hit
GGGAAAAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACG2090.13563237784974008No Hit
GGGGGAGGTGGGGAAGGAGAAGGAATTCTGGGCAGCCCCTTCCCACTGTG2090.13563237784974008No Hit
GGGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGA2090.13563237784974008No Hit
GGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCACCCGA2080.13498341910404757No Hit
GGGGGTGTTGTGTTTCTGCCTAGGGGTGAAGAGCCAAAAGATAGAACAGA2070.134334460358355No Hit
GGGGACAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTG2070.134334460358355No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA2070.134334460358355No Hit
GGGGCTTTTTGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAA2060.1336855016126625No Hit
GGGACATGAAGTGTCTACCTTCTGCAGACTACAGTGGCTCAGGAACCGGG2060.1336855016126625No Hit
GGGGAAGACAATCTGCATCTTCACAGGAGGGATGGCCATGCTCCTGGGGG2060.1336855016126625No Hit
GGGGTCACTTGCTCAGCCTTCCCCTCCATCCTTCCCACCTGTTGATTATT2040.1323875841212774No Hit
GGGGAATAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAA2020.13108966662989233No Hit
GGGGACTATTCTCAAGACCTGGGTTCCAGCCACTTTCCTACTGGCCCCGA2020.13108966662989233No Hit
GGGGTGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC2020.13108966662989233No Hit
GGGGGAGCACAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAG2010.1304407078841998No Hit
GGGGACAGAGTCTGAGTTCTGGGGCCTGGAACCTCAATGTGCACTTGAAC2000.12979174913850727No Hit
GGGGAGACTCAACAGTGTCAGTGTAGTGACTAACCCTCCTACTTTTGGTG2000.12979174913850727No Hit
GGGGGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA1990.12914279039281473No Hit
GGGGGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTAGAAC1990.12914279039281473No Hit
GGGGGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGAGA1990.12914279039281473No Hit
GGGGGCATGAGTTTTTCTGGCAGAGGAGTTTATGTAAAGGGTTGGCCCAG1990.12914279039281473No Hit
GGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTT1990.12914279039281473No Hit
GGGGATGTATTACTGTGACAATAACAATGACATGCGCTTTGGAGCAGGGA1980.1284938316471222No Hit
GGGGGTCTCTGAAGGAACCCCGGTGCTGCTGAGGTGCAACTACTCATCTT1970.12784487290142965No Hit
GGGGGAAAATCCCCTTTGATTTCTAAAGTAAATGTAGAGACGTTTTAAAA1970.12784487290142965No Hit
GGGGGTTTTTGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTC1960.1271959141557371No Hit
GGGGGGTCAGACAACACACTGACTGAGGACAGGAGGATGGATTCGATGAC1960.1271959141557371No Hit
GGGCAGGCAACATGCTCACCTTTGGAGGGGGAACAAGGTTAATGGTCAAA1940.12589799666435206No Hit
GGGGTAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAAACGTGT1940.12589799666435206No Hit
GGGGTGTGTGCATCAGGAGGAAGCTACATACCTACATTTGGAAGAGGAAC1940.12589799666435206No Hit
GGGGGGTGTTGTGTTTCTGCCTAGGGGTGAAGAGCCAAAAGATAGAACAG1930.12524903791865952No Hit
GGGGGAAAAGGCCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGG1920.12460007917296698No Hit
GGGGAGTAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAG1910.12395112042727444No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT1910.12395112042727444No Hit
GGGACTACGCTCACTGTGAAGCCAAATATCCAGAACCCTGACCCTGCCGT1910.12395112042727444No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG1910.12395112042727444No Hit
GGGGTTTCAGTGTATCTCTTCTGGTATGTGCAATACCCCAACCAAGGACT1900.12330216168158191No Hit
GGGGGCCCAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTG1900.12330216168158191No Hit
GGGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCTGTGAAACC1890.12265320293588935No Hit
GGGGGAGATATAGCATCTGAGGACTGACTGTCTAGCTTAGACTGCTGTCT1890.12265320293588935No Hit
GGGAGAGCTGGAAACACCTCCATCCTGCCTCTTCATGCCATGGCCTCCCT1890.12265320293588935No Hit
GGGAAATAGCTAAGGGATGGAGACTGTTCTGCAAGTACTCCTAGGGATAT1860.12070632669881176No Hit
GGGGAGTGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGG1850.12005736795311923No Hit
GGGGGCAGAAGGTGGTTGAGAGGCAGAGCTGCCCCTGAGTGAGCCATGCA1840.11940840920742668No Hit
GGGGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGATG1830.11875945046173415No Hit
GGGATTGTGTGATCAAAGCTGCAGGCAACAAGCTAACTTTTGGAGGAGGA1820.11811049171604161No Hit
GGGACCAGACTGCTGGTCAGGCCTGATATCCAGAACCCTGACCCTGCCGT1810.11746153297034909No Hit
GGGATGAATAAAGCACAGGAGGTTGAAGTCAGATTTGCAGCTTTCTAGGC1800.11681257422465653No Hit
GGGAAGAAGAAGCATGGAAGATTAATTGCCACAATAAACATACAGGAAAA1800.11681257422465653No Hit
GGGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA1800.11681257422465653No Hit
GGGGGCAGACCAGAATCCTGCCCTGGGCCTTGCCTGGTCTGCCTCACTCT1800.11681257422465653No Hit
GGGGGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGGCTG1800.11681257422465653No Hit
GGGGGATAAACATCTGTCTCTGCGCATTGCAGACACCCAGACTGGGGACT1800.11681257422465653No Hit
GGGGAGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAG1790.116163615478964No Hit
GGGAGGAAATAATTCTTTGCTGATAAGGATGCTCCTTGAACATTTATTAA1790.116163615478964No Hit
GGGACAGTGGCTCAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCCT1790.116163615478964No Hit
GGGGGTCTATGTCAATTGAAGCCCAGGACCAAGTCTGGAATCAAGGAATG1780.11551465673327145No Hit
GGGGAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCA1770.11486569798757892No Hit
GGGGCCCGACGTGCTGCAGCAAGTGCCTTTGCCCTGCCTGTGGGCTCCCT1770.11486569798757892No Hit
GGGGGAAATGCACCTATTCAGTCTCTGGAAACCCTTATCTTTTTTGGTAT1760.1142167392418864No Hit
GGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTA1760.1142167392418864No Hit
GGGGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAAT1760.1142167392418864No Hit
GGGAAAGTATCTCTGCTATGTTCATTTCTTTTTGGATTGAAAATTTTAAT1760.1142167392418864No Hit
GGGAAGCACAGAGGAGAACCCATCAGAGCAGGAGACTTTTCACTCTGCAG1760.1142167392418864No Hit
GGGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCA1740.11291882175050133No Hit
GGGGGAGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGT1730.11226986300480878No Hit
GGGATCAGACACAGAGTCTGAGTTCTGGGGCCTGGAACCTCAATGTGCAC1710.11097194551342371No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA1710.11097194551342371No Hit
GGGATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTCTTCTGTGATTTC1710.11097194551342371No Hit
GGGGAGCACAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGG1700.11032298676773118No Hit
GGGGGAATCCTCAGTGAACCAGGGCAGAGAAGAATGATGAAATCCTTGAG1690.10967402802203863No Hit
GGGCAAAGGGGATACCCGTACACCGATAAACTCATCTTTGGAAAAGGAAC1690.10967402802203863No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA1670.10837611053065357No Hit
GGGACAGATCACTTGTCCCTGGAGATATAGCATCTGAGGACTGACTGTCT1670.10837611053065357No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT1660.10772715178496103No Hit
GGGGACTCTGCCATGGGCTGCAGGCTCCTCTGCTGTGTGGTCTTCTGCCT1650.10707819303926851No Hit
GGGAAGGGGAACCAAGTGGTGGTCATACCAAATATCCAGAACCCTGACCC1640.10642923429357595No Hit
GGGGAGTGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGGGCCTGCT1640.10642923429357595No Hit
GGGGACTTTCGGGAAGGGGACCAAACTCTCGGTCATACCAAGTAAGTTCT1640.10642923429357595No Hit
GGGGGTCTGTGCTAAGGGAGGTGGGGAAGGAGAAGGAATTCTGGGCAGCC1640.10642923429357595No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC1630.10578027554788343No Hit
GGGGGAGGTGACACAGATTCCTGCAGCTCTGAGTGTCCCAGAAGGAGAAA1630.10578027554788343No Hit
GGGGGGTTTTTGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTT1630.10578027554788343No Hit
GGGGACTTGTCCCTGGAGATATAGCATCTGAGGACTGACTGTCTAGCTTA1630.10578027554788343No Hit
GGGGATCTCTGCTATGTTCATTTCTTTTTGGATTGAAAATTTTAATCCTC1620.10513131680219087No Hit
GGGGGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTGCT1610.10448235805649836No Hit
GGGGAGGAATTCTGGGCAGCCCCTTCCCACTGTGCTCCTACAATGAGCAG1610.10448235805649836No Hit
GGGGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCCTATCT1600.1038333993108058No Hit
GGGGATGATTTTTAAAGTAGAAATATCCATTCCAGGTGCATTTTTTAAGG1600.1038333993108058No Hit
GGGATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCACAGGA1600.1038333993108058No Hit
GGGATTCAGGAGGAAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA1590.10318444056511328No Hit
GGGGACAGAAGGAATGGAGACCCTCTTGGGCCTGCTTATCCTTTGGCTGC1580.10253548181942072No Hit
GGGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGG1580.10253548181942072No Hit
GGGGGTCAGAGTGTCTATGTGGCTGAATCGTTTCCAGAAAAGACCTCCAG1580.10253548181942072No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG1570.1018865230737282No Hit
GGGGAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAG1570.1018865230737282No Hit
GGGGGAAGAGACTAACCTTTCAGTTTGGTGATGCAAGAAAAGGACAGTTC1560.10123756432803567No Hit
GGGACTTCTGTGCTGTCCGCAGGAGGAGGTGCTGACGGACTCACCTTTGG1550.10058860558234313No Hit
GGGGGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATTTGTTTCTAGGC1550.10058860558234313No Hit

[OK]Adapter Content

Adapter graph