FastQCFastQC Report
Tue 7 May 2024
EGAF00004953574

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953574
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18766
Total Bases3.7 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC50

[WARN]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC9505.062346797399552No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT2221.1829905147607374No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA1790.9538527123521262No Hit
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC1530.8153042736864543No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA1390.7407012682510924No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA1080.5755088990727912No Hit
GGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAGC1080.5755088990727912No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN1060.5648513268677395No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA1030.548864968560162No Hit
GGGGTGACTTCCCTGGTCACCAAGGCAGTGCATGCATGTTGGGGTTTCCT1020.5435361824576361No Hit
GGGGATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTCATCCGTATA1010.5382073963551103No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG1000.5328786102525845No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT970.5168922519450069No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG930.4955771075349035No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC820.4369604604071192No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC810.4316316743045934No Hit
GGGGGGCTCAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCCAT800.4263028882020676No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC740.3943301715869125No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA680.3623574549717574No Hit
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAAT680.3623574549717574No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG680.3623574549717574No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT680.3623574549717574No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT670.3570286688692316No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT660.3516998827667058No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA640.341042310561654No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT630.33571352445912817No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA620.33038473835660237No Hit
GGGAACAAGACTATTTGTTAAAGCAAATATCCAGAACCCTGACCCTGCCG610.3250559522540765No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA600.31972716615155067No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG580.30906959394649897No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA540.2877544495363956No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA530.28242566343386977No Hit
GGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTT530.28242566343386977No Hit
GGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGA520.2770968773313439No Hit
GGGACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAACCA510.27176809122881807No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT510.27176809122881807No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA500.26643930512629227No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT480.25578173292124057No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT470.2504529468187147No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT470.2504529468187147No Hit
GGGAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCC460.24512416071618884No Hit
GGGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGT460.24512416071618884No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCG450.239795374613663No Hit
GGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGAG440.23446658851113714No Hit
GGGAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGA440.23446658851113714No Hit
GGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTAG440.23446658851113714No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG430.2291378024086113No Hit
GGGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGG430.2291378024086113No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT430.2291378024086113No Hit
GGGGGAAACCATCTGCCCTTGTGAGCGACTCCGCTTTGTACTTCTGTGCT430.2291378024086113No Hit
GGGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTA420.22380901630608546No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT420.22380901630608546No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA420.22380901630608546No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT410.2184802302035596No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC410.2184802302035596No Hit
GGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTGA410.2184802302035596No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG400.2131514441010338No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG390.20782265799850794No Hit
GGGGAGCTTTTGCTACACTGGGACTGAGGTGTTCTAAGCCTGGAAAGACA390.20782265799850794No Hit
GGGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGC390.20782265799850794No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC380.20249387189598209No Hit
GGGGGAGACTTCCACTAGAGGGGAAGGTGATCTCACTTGCTCAGCCTTCC380.20249387189598209No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA380.20249387189598209No Hit
GGGAAGCGAAAGGCCAAGGACCCCCCTCGGTCTCCGCCGGATTCTGAGTC370.19716508579345626No Hit
GGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGACTGAGAAGGCTCACGAA370.19716508579345626No Hit
GGGAGGTTACCGTGTCCAGCTAACTCGAGACAGGAAAAGATAGGCTCAGG370.19716508579345626No Hit
GGGACATTTGGAAGAGGAACCAGCCTTATTGTTCATCCGTATATCCAGAA370.19716508579345626No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG370.19716508579345626No Hit
GGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGG360.1918362996909304No Hit
GGGAGCAAAGCTCTCTGCACATCACAGCCTCCCAGCTCAGCGATTCAGCC350.18650751358840456No Hit
GGGGAGTGCTTTGCCAACCTGGCCTGTTTGATCTGGTTTTTGTTGTTGAG350.18650751358840456No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC340.1811787274858787No Hit
GGGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGA330.1758499413833529No Hit
GGGGACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCA330.1758499413833529No Hit
GGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT330.1758499413833529No Hit
GGGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCCCAC330.1758499413833529No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC320.170521155280827No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCAC320.170521155280827No Hit
GGGAGAAGGCAGCTTTGTCAGGAGGTGGAAGGATGAACTAGTTAACCTCA320.170521155280827No Hit
GGGGATACAAGACAAAAGTTACAAACGAAGTGGCCTCCCTGTTTATCCCT320.170521155280827No Hit
GGGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAGGTGTTCCCA320.170521155280827No Hit
GGGGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCT310.16519236917830118No Hit
GGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTTG310.16519236917830118No Hit
GGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTC310.16519236917830118No Hit
GGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGG300.15986358307577533No Hit
GGGGCAGACATCTGTGTACTTCTGTGCCAGCAGTTACGGGGTCGCCGACA290.15453479697324948No Hit
GGGGGAGAAAAGAAGGTTGGAATTATCGTAATTTGTTTCTAGGCTGAGAT290.15453479697324948No Hit
GGGGGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATCTTC290.15453479697324948No Hit
GGGAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCTGTGAGGGACC290.15453479697324948No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA290.15453479697324948No Hit
GGGGGAGTTTGACGCTGTGTGGAATATGGAAACAAGCTGGTCTTTGGCGC290.15453479697324948No Hit
GGGGGAGTTTCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCAGACT290.15453479697324948No Hit
GGGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTT280.14920601087072366No Hit
GGGATTTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG270.1438772247681978No Hit
GGGCAAACAACCTCTTCTTTGGGACTGGAACGAGACTCACCGTTATTCCC270.1438772247681978No Hit
GGGAAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATC270.1438772247681978No Hit
GGGGGGAAACCCTCTGTGCAGTGGAGTGACACAGCTGAGTACTTCTGTGC270.1438772247681978No Hit
GGGGAGTGACTCTGGCTTCTATCTCTGTGCCTCACGGGTGGGGGGGGAGG270.1438772247681978No Hit
GGGGAGCTCCTCTGGGGTTTGCCACACTCATGATGCACTGTGTAGCAATC270.1438772247681978No Hit
GGGGAACAATGACATGCGCTTTGGAGCAGGGACCAGACTGACAGTAAAAC260.13854843866567196No Hit
GGGAGAGACTCTGCCGTCTACATCTGTGCTGCCTTAAACCAGTGGCTCTA260.13854843866567196No Hit
GGGAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGA260.13854843866567196No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA260.13854843866567196No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA260.13854843866567196No Hit
GGGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTT250.13321965256314613No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTC250.13321965256314613No Hit
GGGGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAACA250.13321965256314613No Hit
GGGGGAATTATCGTAATTTGTTTCTAGGCTGAGATACCAGCATGGAGAAA250.13321965256314613No Hit
GGGGAGAGGCCCCATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCTGCT250.13321965256314613No Hit
GGGGATAGATAATGCAGGTATGCCCACAGAGCGATTCTCAGCTGAGAGGC250.13321965256314613No Hit
GGGAGATGCCTCTGTGGACAGTTTAAGAAACCACAGTGCTTTGGAGGAAA240.12789086646062028No Hit
GGGAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGA240.12789086646062028No Hit
GGGAGAGGAAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTG240.12789086646062028No Hit
GGGAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTGTCAG240.12789086646062028No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT240.12789086646062028No Hit
GGGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACG240.12789086646062028No Hit
GGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGATT240.12789086646062028No Hit
GGGGAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAGGCAGGAAGCC230.12256208035809442No Hit
GGGAGCGTTTGAAGGAAAACTGTGAGGAAGAAGGGACACTCCATGGTGTT230.12256208035809442No Hit
GGGGATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATC230.12256208035809442No Hit
GGGATAGGACTGTGTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTTG230.12256208035809442No Hit
GGGGGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCACAGGAG230.12256208035809442No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC230.12256208035809442No Hit
GGGGAATACTTCAGTGAGACACAGAGAAACAAAGGAAACTTCCCTGGTCG230.12256208035809442No Hit
GGGAGAGCAGGAGACTTTTCACTCTGCAGGGGAGCGCTGTCAGCATGACA230.12256208035809442No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT230.12256208035809442No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT230.12256208035809442No Hit
GGGGAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGT220.11723329425556857No Hit
GGGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTC220.11723329425556857No Hit
GGGGAATCCGTCTCCACTCTGACGATCCAGCGCACACAGCAGGAGGACTC220.11723329425556857No Hit
GGGGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCT220.11723329425556857No Hit
GGGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTA220.11723329425556857No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC220.11723329425556857No Hit
GGGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGT220.11723329425556857No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA220.11723329425556857No Hit
GGGAGTGGTCACAACTCTGACAGTGACCAGTGCCCATCCTGAAGACAGCA220.11723329425556857No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC210.11190450815304273No Hit
GGGGAAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTGGAGA210.11190450815304273No Hit
GGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTT210.11190450815304273No Hit
GGGGGAGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGT210.11190450815304273No Hit
GGGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATT210.11190450815304273No Hit
GGGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT210.11190450815304273No Hit
GGGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCA210.11190450815304273No Hit
GGGGAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACA210.11190450815304273No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA210.11190450815304273No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGAGAACACAGGCT200.1065757220505169No Hit
GGGGACATCACTGCAGCCCAGCCTGGTGATACAGGCCTCTACCTCTGTGC200.1065757220505169No Hit
GGGACTACGCTCACTGTGAAGCCAAATATCCAGAAGCCTGACCCTGCCGT200.1065757220505169No Hit
GGGGACAGCCGTGAGAAGAAAAGCAGCGGAGACAAGCTGACTTTTGGGAC200.1065757220505169No Hit
GGGGGCAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCC200.1065757220505169No Hit
GGGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGA200.1065757220505169No Hit
GGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATA190.10124693594799104No Hit
GGGGAGTCCCTCCAGCTGCACATGGTCACAGCTGCTCTAAGCCCTGGAGC190.10124693594799104No Hit
GGGAGTGGGGAGAGGTGGGCCCTCGCTGGCAGTTTCTGTAAAGCCTCGTG190.10124693594799104No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA190.10124693594799104No Hit
GGGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGAT190.10124693594799104No Hit
GGGGGAACATGGGCTGAGGCTGATCCATTACTCATATGGTGTTCAAGACA190.10124693594799104No Hit
GGGGGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTG190.10124693594799104No Hit
GGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTG190.10124693594799104No Hit

[OK]Adapter Content

Adapter graph