FastQCFastQC Report
Wed 8 May 2024
EGAF00004953588

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953588
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences55912
Total Bases12.2 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC49

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC6271.1214050651023035No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA4530.810201745600229No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT4450.7958935470024323No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT4270.7637001001573902No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA4060.7261410788381742No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA4010.7171984547145513No Hit
GGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAA3560.6367148376019459No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGGCGATACTGGAG3390.6063099155816283No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT3140.5615967949635141No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA3000.5365574474173702No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG2890.5168836743454No Hit
GGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAACA2710.48469022750035773No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT2640.47217055372728567No Hit
GGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCA2610.46680497925311204No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT2510.4489197310058664No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT2500.44713120618114177No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC2420.4328230075833453No Hit
GGGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAG2340.4185148089855487No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA2260.4042066103877522No Hit
GGGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACG2120.37916726284160823No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC2110.37737873801688365No Hit
GGGGAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGC2100.37559021319215913No Hit
GGGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCAT2060.3684361138932608No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACGT1840.3290885677493204No Hit
GGGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATT1830.3273000429245958No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC1730.3094147946773501No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA1730.3094147946773501No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT1700.30404922020317643No Hit
GGGGGATGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACT1680.30047217055372727No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA1640.293318071254829No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT1630.2915295464301045No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT1630.2915295464301045No Hit
GGGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCT1610.2879524967806553No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGT1590.28437544713120616No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA1550.2772213478323079No Hit
GGGGTAGAGCAGACTGTGGCTTTACCTCGGTGTCCTACCAGCAAGGGGTC1530.27364429818285874No Hit
GGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATC1500.2682787237086851No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG1490.2664901988839605No Hit
GGGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTT1460.2611246244097868No Hit
GGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAA1400.2503934754614394No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN1390.24860495063671484No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG1360.24323937616254113No Hit
GGGGAAGGTTTTTCGTAATGATGCCTGTGGTAGTGCTTTGACAGCACAAC1360.24323937616254113No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG1360.24323937616254113No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA1340.239662326513092No Hit
GGGAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTGGAGGACCTGAAA1320.23608527686364283No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC1270.22714265274002005No Hit
GGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGG1230.21998855344112175No Hit
GGGGATGCTCACAGAGGGCCTGGTCTAGAATATTCCACATCTGCTCTCAC1190.21283445414222352No Hit
GGGAAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT1190.21283445414222352No Hit
GGGAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGC1170.20925740449277436No Hit
GGGAAGAAGAAGCATGGAAGATTAATTGCCACAATAAACATACAGGAAAA1160.2074688796680498No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA1120.2003147803691515No Hit
GGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTCC1110.19852625554442693No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCAC1100.1967377307197024No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT1100.1967377307197024No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT1070.1913721562455287No Hit
GGGGAATGTGCACTTGAACAATGAAGTTGGTGACAAGCATTACTGTACTC1070.1913721562455287No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA1060.18958363142080412No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA1060.18958363142080412No Hit
GGGGGAGAGATGAGATCCTGGCCTGGACCTGAAATGGGCACAAGGTTGTT1050.18779510659607956No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG1050.18779510659607956No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA1040.18600658177135498No Hit
GGGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGA1040.18600658177135498No Hit
GGGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGT1030.1842180569466304No Hit
GGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT990.17706395764773214No Hit
GGGGACAGATACAGAAGACCCCTCCGTCATGCAGCATCTGCCATGAGCAT980.1752754328230076No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC980.1752754328230076No Hit
GGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTGA970.17348690799828304No Hit
GGGTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAG940.16812133352410932No Hit
GGGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAAC930.16633280869938474No Hit
GGGTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC920.1645442838746602No Hit
GGGGAGATCTCTGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTG900.16096723422521106No Hit
GGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTCC870.15560165975103735No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC860.1538131349263128No Hit
GGGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGA850.15202461010158821No Hit
GGGAGAGCAGGAGACTTTTCACTCTGCAGGGGAGCGCTGTCAGCATGACA850.15202461010158821No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA840.15023608527686363No Hit
GGGAGAGGCCCCATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTC830.14844756045213908No Hit
GGGAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTGTCAG830.14844756045213908No Hit
GGGATGCTCACAGAGGGCCTGGTCTAGAATATTCCACATCTGCTCTCACT820.1466590356274145No Hit
GGGAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGTGCTCGAG820.1466590356274145No Hit
GGGGGCAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTT820.1466590356274145No Hit
GGGGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCT810.14487051080268995No Hit
GGGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGG800.14308198597796537No Hit
GGGAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTCTAG800.14308198597796537No Hit
GGGGGCAGACCAGAATCCTGCCCTGGGCCTTGCCTGGTCTGCCTCACTCT790.14129346115324082No Hit
GGGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTT780.13950493632851624No Hit
GGGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA780.13950493632851624No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGG780.13950493632851624No Hit
GGGAGTATCACTGTGTCTTATAACACCGACAAGCTCATCTTTGGGACTGG770.13771641150379166No Hit
GGGACAGTGACCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCC770.13771641150379166No Hit
GGGGCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGCTG770.13771641150379166No Hit
GGGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAG770.13771641150379166No Hit
GGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTT770.13771641150379166No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGA750.13413936185434255No Hit
GGGGAGCTTTTGGCTATACATGCCGGGTAAACTCATCCACCTCTCTGTCA750.13413936185434255No Hit
GGGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCA750.13413936185434255No Hit
GGGAGGGAAAACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCAC750.13413936185434255No Hit
GGGGAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC750.13413936185434255No Hit
GGGAAACATTAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGAC740.13235083702961797No Hit
GGGAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGA740.13235083702961797No Hit
GGGGAGGTGGGGAAGGAGAAGGAATTCTGGGCAGCCCCTTCCCACTGTGC740.13235083702961797No Hit
GGGGGTTGAATACACAAGTCAACTTCTGGGAGCAGATCTCTGCAGAATAA730.1305623122048934No Hit
GGGGAGAGTGTTTATCTTGTGAGCCATTCTCCATATTTCAGATATAAGAT730.1305623122048934No Hit
GGGAGCATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAAC730.1305623122048934No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTT730.1305623122048934No Hit
GGGAAGGCCACATACGAGCAAGGCGTCGAGAAGGACAAGTTTCTCATCAA730.1305623122048934No Hit
GGGAGAACAGACTGTTTTTTGGCAGTGGAACCCAGCTCTCTGTCTTGGAG730.1305623122048934No Hit
GGGAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGTG730.1305623122048934No Hit
GGGAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAA720.12877378738016884No Hit
GGGGAGTCATCCCTCCTCGCTGGTGAATGGAGGCAGTGGTCACAACTCTC720.12877378738016884No Hit
GGGGAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTCTA710.1269852625554443No Hit
GGGGAGCCCAGAGAAGTCTGTTCCAGGACGGGCTCTTTCAGGAGCAGCTA700.1251967377307197No Hit
GGGGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAAT690.12340821290599514No Hit
GGGGAGTGGAGTGTGTGGTGGGGCCCCAAGAGTTCTGTGTGTAAGCAGCT690.12340821290599514No Hit
GGGGACAGTGCTTTGGAGGAAAGGAAGAGATACTTGATAATATAGCTCTC680.12161968808127056No Hit
GGGAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAG680.12161968808127056No Hit
GGGACTTCGGGCCGGGCACCAGGCTCACGGTCACAGAGGACCTGAAAAAC670.119831163256546No Hit
GGGAGGTGGGGAAGGAGAAGGAATTCTGGGCAGCCCCTTCCCACTGTGCT670.119831163256546No Hit
GGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATTT670.119831163256546No Hit
GGGGGATCCGTCTCCACTCTGACGATCCAGCGCACACAGCAGGAGGACTC660.11804263843182142No Hit
GGGAGACACCTGCCTGATGCTGCCATGGGCCCCCAGCTCCTTGGCTATGT650.11625411360709688No Hit
GGGGATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAA630.11267706395764773No Hit
GGGGGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCACAGGAG630.11267706395764773No Hit
GGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCAT630.11267706395764773No Hit
GGGGGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCT630.11267706395764773No Hit
GGGGCATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGG620.11088853913292315No Hit
GGGACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGA620.11088853913292315No Hit
GGGGGAGAAGAGACAACCTGATGATAGAAGTAACTCTTATAACTGGAGGT620.11088853913292315No Hit
GGGGGCATACAGTTAGAGAGAAAGAAAAATGTATCATCAAACCATAGAAT610.10910001430819859No Hit
GGGGAGAATAAAAATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGT610.10910001430819859No Hit
GGGGAGAAAGACTAGGGATTCACCCAGTAAAGAGAGCTCATCTGTGACTG610.10910001430819859No Hit
GGGACACCAGCTCCTCTGGGGTTTGCCACACTCATGATGCACTGTGTAGC610.10910001430819859No Hit
GGGGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGATCTTCG600.10731148948347403No Hit
GGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTC600.10731148948347403No Hit
GGGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGT600.10731148948347403No Hit
GGGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGC600.10731148948347403No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA590.10552296465874947No Hit
GGGTGACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGAT590.10552296465874947No Hit
GGGAGAAGCCTCACACAGCCCAGTAACTTTGCTAGTACCTCTTGAGTGCA590.10552296465874947No Hit
GGGGATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCACAGG590.10552296465874947No Hit
GGGGATCCTGCCCTGACCCTGCCATGGGTACCAGGCTCCTCTGCTGGGTG580.1037344398340249No Hit
GGGAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATCTTA580.1037344398340249No Hit
GGGAAGGTTTTTCGTAATGATGCCTGTGGTAGTGCTTTGACAGCACAACT580.1037344398340249No Hit
GGGACACAGACCCAGAAGACCCCTCCATCCTGTAGCACCTGCCATGAGCA580.1037344398340249No Hit
GGGAGAAACCACCTGGAGCCCCCAGAACTGGCAGACACCTGCCTGATGCT580.1037344398340249No Hit
GGGAGCAAGGTTTTTCGTAATGATGCCTGTGGTAGTGCTTTGACAGCACA570.10194591500930032No Hit
GGGAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTG570.10194591500930032No Hit
GGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATC570.10194591500930032No Hit
GGGAAGGAACAGGAGAGGACCTGGCAGGTGGACTTGGGGAGGCAGGAGTG570.10194591500930032No Hit
GGGGAAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATC570.10194591500930032No Hit
GGGGGAGCCCCACCAGGGAGACCCAGTGACATAGATGGTCTGCTCAGGGT570.10194591500930032No Hit
GGGAGACTGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATA560.10015739018457576No Hit
GGGATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAAG560.10015739018457576No Hit
GGGGGTCCTCACTGTGTGCATCAGGAGGAAGCTACATACCTACATTTGGA560.10015739018457576No Hit
GGGGGACGCTGTGTGGAATATGGAAACAAACTGGTCTTTGGCGCAGGAAC560.10015739018457576No Hit
GGGGGGGACTGGAACAAGACTTCAGGTCACGCTCGATATCCAGAACCCTG560.10015739018457576No Hit

[OK]Adapter Content

Adapter graph