FastQCFastQC Report
Wed 8 May 2024
EGAF00004953608

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00004953608
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences209726
Total Bases46.2 Mbp
Sequences flagged as poor quality0
Sequence length35-300
%GC50

[WARN]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC27051.2897780914145123No Hit
GGGGGACTGACTAAGAAACACTGTGGGATGGATAGCAGCTATAAATTGAT21221.0117963438009592No Hit
GGGGGATCTTAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATT19760.9421817037467934No Hit
GGGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAG16690.7958002345918006No Hit
GGGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAAT14980.7142652794598666No Hit
GGGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCC14160.6751666460047873No Hit
GGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCT13750.6556173292772475No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTT13410.6394057007714827No Hit
GGGAGCCTTACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGG12650.6031679429350676No Hit
GGGATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGG12150.5793273127795314No Hit
GGGAGTATAGGCTCCCTAGACCTGCTCCCCAGCTGTGGTGTAAAAATGGA11530.5497649313866664No Hit
GGGGAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTA11480.5473808683711128No Hit
GGGGAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGC11360.5416591171337841No Hit
GGGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAA10700.5101894853284762No Hit
GGGATTGTGGGGACGGGAGCTCCTACAATGAGCAGTTCTTCGGGCCAGGG10480.4996996080600402No Hit
GGGAGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTG10430.4973155450444866No Hit
GGGGAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTGCTCCTTCT10400.49588510723515444No Hit
GGGGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTT10240.4882561055853828No Hit
GGGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTAT9810.4677531636516216No Hit
GGGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA9270.44200528308364245No Hit
GGGGGGATTGAAAATTTTAATCCTCAGTGAACCAGGGCAGAAAAGAATGA9140.4358067192432031No Hit
GGGGTAGAGGAGTTTGACGCTGTGTGGAATATGGAAACAAACTGGTCTTT8940.42627046718098854No Hit
GGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGTG8770.41816465292810623No Hit
GGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCC8470.4038602748347844No Hit
GGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTG8420.4014762118192308No Hit
GGGGAAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGT8410.4009993992161201No Hit
GGGGGATGATGGAAGTAGCTCTTATGGCTGGAGATTGCAGGTTTATGACT8220.3919399597570163No Hit
GGGAGAAGAGGAGGCTTCTCACCCTGCAGCAGGGACCTGTGAGCATGGCA7970.38001964467924815No Hit
GGGGACAGTGACCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGC7890.3762051438543623No Hit
GGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAGA7730.36857614220459073No Hit
GGGGGCTTCTCACCCTGCAGCGGGGACCTGTGAGCATGGCATGCCCTGGC7510.3580862649361548No Hit
GGGGAGATAAGAAAGAACTTTTCAGCATCCTGAACATCACAGCCACCCAG7450.3552253893174904No Hit
GGGGTTGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAA7430.354271764111269No Hit
GGGGGGGATAGTGTATCATAAGGTCGGAGTTCCAGGAGGACCCCTTGCGG7410.35331813890504754No Hit
GGGGGCACTGCCAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGT7360.35093407588949393No Hit
GGGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGCCT7250.3456891372552759No Hit
GGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTT7150.3409210112241687No Hit
GGGACAGACCCAGAGGACCCCTCCATCCTGCAGTTCCTGCCATGAGCCTC7120.3394905734148365No Hit
GGGATAGGACTGTGTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTTG6990.33329200957439703No Hit
GGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAA6960.3318615717650649No Hit
GGGGATGCCCCAACGTGACAACAGCTTGGAGAGGGGTGGGTACTGGAGAA6950.33138475916195415No Hit
GGGGGTGCTCAGCAGAGACTGGGGGGTTTTGAAGTGGCCCTGGGAGGCTG6950.33138475916195415No Hit
GGGGAGGACAGATTTCTTTTATGATTCCTACAGCAGAAAAATGAGAAACG6910.32947750874951126No Hit
GGGGGAGCTGAGTCTGGGACAGCAGAGCGGGCAGCACCGGTTTTTGTCCT6790.32375575751218255No Hit
GGGGGAGAAGGAAGCCCCCGGCCTGGTCCATACCCCACCACCAACTTGCA6650.3170803810686324No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN6650.3170803810686324No Hit
GGGAGGACAGATTCTTTTTATGATTCCTAAAGTGGAAGAAATAAAGTATC6490.3094513794188608No Hit
GGGAAATCACTGTGGGAAATACTGGAGGCTTCAAAACTATCTTTGGAGCA6470.3084977542126393No Hit
GGGGAAATGGCCTGTGTAAAAAGGAAGTGAAAATGTAACCCGTATCTCCT6410.305636878593975No Hit
GGGGAAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTGGAGA6400.30516006599086426No Hit
GGGAGGACAGATTTCTTTTATGATTCCTACAGCAAGTATATCTCCTTGTT6380.3042064407846428No Hit
GGGGATACTCAAGGTTCAGATCAGAAGAGGAGGCTTCTCACCCTGCAGCA6350.3027760029753106No Hit
GGGAGGGTTCTTGTAAAGGCCTCCAGTGCAGTGCTAATGCTGGTGGTACT6330.30182237776908916No Hit
GGGATGCAGAGAGGTGAGAGCAGCTCTTCAGAAGCGCTGGCAAAATGAAA6320.3013455651659785No Hit
GGGGAAAGGAAAGGACTGAGCTTGCCTGTGACTGGCTAGGGAGGAACCTG6270.29896150215042483No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGGCGATACTGGAG6220.2965774391348712No Hit
GGGATCAATGCACAGATACAGAAGACCCCTCCGTCATGCAGCATCTGCCA6200.2956238139286498No Hit
GGGAGGGAGACAGCGCTGTTATCAAGTGTACTTATTCAGACAGTGCCTCA6160.29371656351620684No Hit
GGGGAGAATGTGGAGCAGCATCCTTCAACCCTGAGTGTCCAGGAGGGAGA6160.29371656351620684No Hit
GGGAGAATGATGGTTTTTGCAATGACTTAGAACACTGTGTATCTAACTTT6160.29371656351620684No Hit
GGGGATATTCCGAAATCCTCCAACAGAGACCTGTGTGAGCTTCTGCTGCA6120.29180931310376396No Hit
GGGGAGTGGCTCAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCCTG6070.28942525008821035No Hit
GGGGGGGGCCAACGTCCTGACTTTCGGGGCCGGCAGCAGGCTGACCGTGC5950.28370349885088164No Hit
GGGGGATTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAACCTAACATT5910.28179624843843876No Hit
GGGATGCTCACAGAGGGCCTGGTCTAGAATATTCCACATCTGCTCTCACT5900.281319435835328No Hit
GGGAAAACACTGTGATACTCACGGGAGGAGGAAACAAACTCACCTTTGGG5880.28036581062910654No Hit
GGGTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACAGC5860.2794121854228851No Hit
GGGAATGCACAGATACAGAAGACCCCTCCGTCATGCAGCATCTGCCATGA5850.2789353728197744No Hit
GGGGAGAAAAAAGAATGATGAAATCCTTGAGAGTTTTACTGGTGATCCTG5830.27798174761355293No Hit
GGGATCCTTCCCACCTGTTGATTATTGTAAAGCCCCATAGGACTGTGTGA5810.2770281224073315No Hit
GGGCTGGTGACCCCAAAGCAAGGAGGACCTAGTAACATAATTGTGCTTCA5770.2751208719948886No Hit
GGGGGAGACTTCCACTAGAGGGGAAGGTGATCTCACTTGCTCAGCCTTCC5750.27416724678866716No Hit
GGGACCAGACAGCTCTTAGAGCAACCCTAGCCCCATTACCTCTTCCCTTT5720.27273680897933494No Hit
GGGGGGAGAAAGGCTCAGTTCAAGTGTCAGACTCAGCGGTGTACTTCTGT5700.2717831837731135No Hit
GGGGATTGCAGCTCAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGT5650.2693991207575599No Hit
GGGGAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTGCT5580.2660614325357848No Hit
GGGGAGTTGCTGCTGGGCTCATTGCAGCTCAGACACAGCAAAAGAGCCTA5570.26558461993267407No Hit
GGGGACGAAACCCTCAGCCCATATGAGCGACGCGGCTGAGTACTTCTGTG5570.26558461993267407No Hit
GGGGGATCTGGTTTTTGTTGTTGAGCAAATCATAGTGTTTCTTCTGGTTC5540.26415418212334185No Hit
GGGATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACTGACTAAGAAA5480.2612933065046775No Hit
GGGGATATCTCTAGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGT5470.2608164939015668No Hit
GGGGGAAGCTTTCTTTGGACAAGGCACCAGACTCACAGTTGTAGAGGACC5460.2603396812984561No Hit
GGGGGGCTTCTGGGTGTTTTTGACTGACTAAGAAACACTGTGGGATGGAT5450.25986286869534536No Hit
GGGCATCCTGCCCTGACCCTGCCATGGGCACCAGCCTCCTCTGCTGGATG5450.25986286869534536No Hit
GGGGATCAAAGGCTGTCCTCACTGTGTGCATCAGGAGGAAGCTACATACC5430.2589092434891239No Hit
GGGGGCTTTGAGGCCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTCC5410.2579556182829025No Hit
GGGGGAAATGGAGAGAGATGGGAGGCAGGAAGCCGGACCTCGGGGGACGC5400.2574788056797917No Hit
GGGGAGTGCCAGGCTCATGGTATCCTGCAGCAGATGTGGGGAGCTTTCCT5380.25652518047357026No Hit
GGGGCATTTGAGTAGTGCTGAGGACTGGGTCTGACCTTGAGTAAACGCCT5380.25652518047357026No Hit
GGGACTGAACTTTGAGCTTCAGGCAGCACAACTCACATTTGTGCAAAGAG5300.2527106796486845No Hit
GGGGACAATGAGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAGA5270.2512802418393523No Hit
GGGGGAGAAGACCAGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGC5270.2512802418393523No Hit
GGGGAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAG5240.2498498040300201No Hit
GGGGAGGATCAGACACAGAGTCTGAGTTTCTGGGGCCTGGAACCTCAATG5220.24889617882379866No Hit
GGGGGACTTGATTATGAAATGCTACCAGTTTGAAGCAGTCACTGAAAAAC5170.24651211580824506No Hit
GGGGGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCT5170.24651211580824506No Hit
GGGGAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCTG5130.24460486539580215No Hit
GGGGAGGAAAAGATAGGCTCAGGAAAGAGAGGAAGGGTGTGCCCTCTGTC5120.2441280527926914No Hit
GGGAGTAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGG5100.24317442758646995No Hit
GGGGACCTTTAGAAAGAGAGATGCTGAACATGAGAAATCAGTAAGCCTCA5060.24126717717402707No Hit
GGGGATTACAGTGTGAATTCTGGGGGTTACCAGAAAGTTACCTTTTGGAA5040.2403135519678056No Hit
GGGGACTGTGATTTCTTCATGTTAAGGATCAAGACCATTATTTGGGTAAC5030.2398367393646949No Hit
GGGGATTTTGTACTGTGATGTACCAGGGTGTGGACACGGGCAGGAGAGCA5020.23935992676158416No Hit
GGGGACAAAGACATCCAGCTCTAAGGAGCTCAAAACATCCTGAGGACAGT5010.23888311415847346No Hit
GGGAAAACATCCTGAGGACAGTGCCTGGAGAGGACCTGAAAAACGTGTTC4990.237929488952252No Hit
GGGGGCAGCTTCTTCAGAGAGAGACAATGGAAAACAGCAAAAACTTCGGA4930.23506861333358764No Hit
GGGGATTTTGGTGCCAGTGACAGGGAAGAGCAGAGGGGCTTAGGAGGTTT4930.23506861333358764No Hit
GGGACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTT4930.23506861333358764No Hit
GGGGGTCTTAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGTTTTTGACT4820.22982367469936965No Hit
GGGAGACAATCTGCATCTTCACAGGAGGGATGGCCATGCTCCTGGGGGCA4790.2283932368900375No Hit
GGGAGACAGCCCTGAGATCACCTAAAAAGCTGCTACCAAGACAGCCACGA4770.22743961168381605No Hit
GGGAATTGGGAAGAACAAGGATGACATCCATTCGAGCTGTATTTATATTC4700.22410192346204094No Hit
GGGAGACACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGA4690.22362511085893022No Hit
GGGATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGA4660.22219467304959803No Hit
GGGGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTTCA4650.22171786044648734No Hit
GGGGATTCACCATCTCTCTTCTGGTATGTGCAACACCCCAACAAAGGACT4640.2212410478433766No Hit
GGGGACACTCATGATGCACTGTGTAGCAATCAGCCCCAGCATTTTGGTGA4630.2207642352402659No Hit
GGGGAACACACTAAAGATGAACTATTCTCCAGGCTTAGTATCTCTGATAC4600.21933379743093367No Hit
GGGGGAAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGC4580.21838017222471223No Hit
GGGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCA4480.21361204619360497No Hit
GGGGATTCTGAGTTCAAAGCAACTCCTGTTAAGGAAGCCCATTCAGAAGC4480.21361204619360497No Hit
GGGGACCAAAACAAGAGACTTGCCTAGCCCAACCTTCCTCACGCTCGCTA4450.21218160838427283No Hit
GGGGAAGATGCTGTCATCAACTGCAGAACCTACTTCTGCGGCACAGAGAG4440.21170479578116208No Hit
GGGGGATGTGTTTTTGACAGGATATGTAACACAGTGTGATTTATAACCAG4410.21027435797182992No Hit
GGGGAGAGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAA4410.21027435797182992No Hit
GGGGGCATACAGTTAGAGAGAAAGAAAAATGTATCATCAAACCATAGAAT4380.20884392016249773No Hit
GGGATTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTATCT4370.20836710755938703No Hit
GGGAGACAGATGCTTCATTCCTGTATGGGGTGGTATTCCTGCCATGGGTC4360.20789029495627628No Hit
GGGGAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTCTA4350.20741348235316556No Hit
GGGAGTGCTTTGGAGGAAAGGAAGAGATACTTGATAATATAGCTCTCTTG4310.20550623194072268No Hit
GGGGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGG4280.20407579413139046No Hit
GGGGAAAGAGAGCTCATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTC4170.1988308554971725No Hit
GGGGATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGGCCTGG4140.1974004176878403No Hit
GGGGGAGAGAGGGCCAGGGGGGCAGGAGAGCACTTACTTTTGGGAGTGGA4100.1954931672753974No Hit
GGGGATTGTACATTTCCTCTTCCCAGACCACAGACTCAGGCGTTTATTTC4100.1954931672753974No Hit
GGGTGAGCAGCAAACAGGAGGTGATAGCGCTATTTACAACCTCCAGTGGT4100.1954931672753974No Hit
GGGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATT4080.19453954206917598No Hit
GGGACAGCATAGAAAGGAGGGGCAAAGTGGAGAGAGAGCAACAGACACTG4070.19406272946606526No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGGCATGGGGC4030.19215547905362235No Hit
GGGAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAAC3970.189294603434958No Hit
GGGATTTGTCCTTGAAGTATGAGGCTGGTGGCAAGAGTAACTGTGTTTCT3960.18881779083184727No Hit
GGGGGGGGCCCCAAGAGTTCTGTGTGTAAGCAGCTTCTGGAAGGAAGGGC3940.18786416562562583No Hit
GGGGGCCCCTTCGCCAAACAGCCTTACAAAGACATCCAGCTCTAAGGAGC3920.18691054041940436No Hit
GGGATCAAACACTGTGATACTCACGGGAGGAGGAAACAAACTCACCTTTG3920.18691054041940436No Hit
GGGACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGA3900.18595691521318292No Hit
GGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAAT3890.1854801026100722No Hit
GGGGAGCTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAA3870.18452647740385075No Hit
GGGGGTTCATATGTAAAATGAAGGGTCTGTGGAAGGACATGAATAAAGCA3860.18404966480074003No Hit
GGGGAGAGCAGCTGTGGAGGTTACGGGAGGTTCAGGGCATGAGTTTTTCT3860.18404966480074003No Hit
GGGGGATACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTA3850.18357285219762928No Hit
GGGACAGCAAAAGAGCCTAGAACCTGGGTCCTAGTTTGCACCTAGAATAT3840.18309603959451856No Hit
GGGATATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAA3820.18214241438829712No Hit
GGGGTGTTTCTGTAAAGCTGCTGACAGCCGTGAGAAGAAAAGCAGCGGAG3820.18214241438829712No Hit
GGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGCT3810.1816656017851864No Hit
GGGGACTGTCGCTTTCAACTGTACTTACAGCAACAGTGCTTCTCAGTCTT3810.1816656017851864No Hit
GGGGCTGGGAGAGCGATGGGGCTCTCAGCGGTGGGAAGGACCCGAGCTGA3780.1802351639758542No Hit
GGGAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCA3760.17928153876963276No Hit
GGGGATGAAAAGAAGAAAGGACGAATAAGTGCCACTCTTAATACCAAGGA3740.17832791356341132No Hit
GGGGGTGTTTCTGCCTAGGGGTGAAGAGCCAAAAGATAGAACAGAATTCC3720.17737428835718985No Hit
GGGAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTGCATCTTCAC3720.17737428835718985No Hit
GGGGAGACTGCTGTCTGCACAAGAAGAAGACTTACAGATGCTTAAGGAGG3710.17689747575407913No Hit
GGGAAAAAAAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGT3700.1764206631509684No Hit
GGGAAAAACATCCTGAGGACAGTGCCTGGAGGTGAGAAGGAAGCCCCCGG3700.1764206631509684No Hit
GGGGAGATTTGCAGCTTTCTAGGCAGGAGATAAGACAATCTGCATCTTCA3690.1759438505478577No Hit
GGGGAGGTGGTGTGAGGCCATCACGGAAGATGCTGCTGCTTCTGCTGCTT3690.1759438505478577No Hit
GGGGAAACAGAATGGCTTTTTGGCTGAGAAGCCTGGGTCTACATTTCAGG3680.17546703794474697No Hit
GGGGGAAAAACACACTTGATAACTGAAGGATGATGAAGTGTCCACAGGCT3680.17546703794474697No Hit
GGGGATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAG3660.1745134127385255No Hit
GGGGGGGGCCGGCAGCAGGCTGACCGTGCTGGAGGACCTGAAAAACGTGT3620.1726061623260826No Hit
GGGGGCATTTTTTAAGGGTTTAAAATTTGAATCCTCAGTGAACCAGAACA3610.1721293497229719No Hit
GGGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCA3610.1721293497229719No Hit
GGGGAGAGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAG3600.17165253711986114No Hit
GGGGCATTTTGGCCATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTA3600.17165253711986114No Hit
GGGGACTGTGAGCAGCATGAGCCCTGAAGACAGCAGCATATATCTCTGCA3580.1706989119136397No Hit
GGGAGACACAGAGTCTGAGTTCTGGGGCCTGGAACCTCAATGTGCACTTG3570.17022209931052898No Hit
GGGGAAAGGGGACCAGCATTGTGCCGACAGAGGCTCAACCCTGGGGAGGC3540.16879166150119682No Hit
GGGAGATATAAGATTTCAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATG3530.16831484889808607No Hit
GGGGATAGAAGTAACTCTTATAACTGGAGGTTGCAGGTCAATGACTGATC3530.16831484889808607No Hit
GGGAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCCTGCAGCAGATG3520.16783803629497535No Hit
GGGGAGAGGGGCTGTGCTGAGAGGCGCTGCTGGGCGTCTGGGCGGAGGAC3510.16736122369186462No Hit
GGGGAAGAAACGGGGCAGGGGCTTGCAGTAGAGTCTGGAGAGTTTAGAAT3440.16402353547008955No Hit
GGGGATAATATAGCTCTCTTGGCTGGAGATTGCAGGTCCCAGTGGGGAGA3430.16354672286697883No Hit
GGGATTTTGTAAAGGCAGGCATTACAGTGTGAATTCTGGGGGTTACCAGA3430.16354672286697883No Hit
GGGGGGGCCCACACCAGCTCCTCTGGGGTTTGCCACACTCATGATGCACT3420.1630699102638681No Hit
GGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCA3420.1630699102638681No Hit
GGGGGATTATTGTAAAGCCCCATAGGACTGTGTGAATTATGGAGGAAGCC3420.1630699102638681No Hit
GGGGTACTTCTGTGCTGTGAGGCTGGGTGGTTCTGCAAGGCAACTGACCT3400.16211628505764664No Hit
GGGGGCATTTTTTAAGGGTTTAAAATTTGAATCCTCAGTGAACCAGGGCA3400.16211628505764664No Hit
GGGGGGGATTCACCCCTCCACTTTGGGAATGGGACCAGGCTCACTGTGAC3400.16211628505764664No Hit
GGGGAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAA3390.16163947245453592No Hit
GGGGGACTCAGCAATGTATTTCTGTGCAATGAGAGAGGGCCGGGGTAGCA3390.16163947245453592No Hit
GGGGCTCACAGTGACCCTGATTGGGCAAAGCTCCCATCCTTCCCTGACCC3360.16020903464520375No Hit
GGGGACAGTGACCCTGATCTGGCAAAGCTTCCATCCTGCCCTGACCCTGC3330.15877859683587156No Hit
GGGATTCCTGCTGTGATCCTGCCATGGATACCTGGCTCGTATGCTGGGCA3330.15877859683587156No Hit
GGGGGGGCCCCAAGAGTTCTGTGTGTAAGCAGCTTCTGGAAGGAAGGGCC3330.15877859683587156No Hit
GGGACTCCGACCATGCTGGGAATAGACCGCCATAATAAACAGTCTTTTCC3320.15830178423276084No Hit
GGGGGGATTAGGTATGTCAGCTGTGCCAGACCCCTGATCTTTGGCAAAGG3320.15830178423276084No Hit
GGGGACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGC3310.15782497162965012No Hit
GGGAACTTCTGGGAGCAGATCTCTGCAGAATAAAAATGAAAAAGCATCTG3310.15782497162965012No Hit
GGGAAAGGCCCTGAATTCCTCTTCACCCTGTATTCAGCTGGGGAAGAAAA3300.1573481590265394No Hit
GGGGGAGACTAACCTTTCAGTTTGGTGATGCAAGAAAGGACAGTTCTCTC3290.15687134642342868No Hit
GGGGGTGTGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGG3270.1559177212172072No Hit
GGGGGACTCTGCTCTCTGTCCTGTCTCCTCATCTGCAAAATTAGGAAGCC3250.15496409601098576No Hit
GGGGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCAC3250.15496409601098576No Hit
GGGGTAAGCCTCAAGACAAAAACCAGAGGAAATGGAGAGAGATGGGAGGC3240.15448728340787504No Hit
GGGGAGACCCAGAGGACCCCTCCATCCTGCAGTTCCTGCCATGAGCCTCG3210.15305684559854285No Hit
GGGGGACCCTGCCATGGGCACCAGCCTCCTCTGCTGGATGGCCCTGTGTC3200.15258003299543213No Hit
GGGGAGGAAGCTACATACCTACATTTGGAAGAGGAACCAGCCTTATTGTT3200.15258003299543213No Hit
GGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCTTACAAAGACA3190.1521032203923214No Hit
GGGGCTCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTCACA3190.1521032203923214No Hit
GGGATTTTTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGTA3180.1516264077892107No Hit
GGGGGTATTACTGTGACAATAACAATGACATGCGCTTTGGAGCAGGGACC3180.1516264077892107No Hit
GGGATCCTGAGGACAGTGCCTGGAGAGGACCTGAACAAGGTGTTCCCACC3180.1516264077892107No Hit
GGGGGTTGAGCTTCCTATCACAGTGGAACACCGGTAACCAGTTCTATTTT3180.1516264077892107No Hit
GGGGATTTTGGTGATGGGACTCGACTCTCCATCCTAGAGGACCTGAACAA3160.15067278258298925No Hit
GGGGAATCAGATGCAGTGCTTCCTGTCCCTCTGTGCCATGGGCCCCGGGC3140.14971915737676778No Hit
GGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGA3140.14971915737676778No Hit
GGGCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATGC3130.14924234477365705No Hit
GGGGAGCTAACTCGAGACAGGAAAAGATAGGCTCAGGAAAGAGAGGAAGG3130.14924234477365705No Hit
GGGATATCTCTAGGTATAGGTATGAAAAGGATGTGTGGGCTTCTGGGTGT3120.14876553217054633No Hit
GGGGATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTCTGCTGTGC3120.14876553217054633No Hit
GGGAATAATGCAGGCAACATGCTCACCTTTGGAGGGGGAACAAGGTTAAT3110.1482887195674356No Hit
GGGGGGCAGAAAAGAATGATGAAATCCTTGAGAGTTTTACTGGTGATCCT3110.1482887195674356No Hit
GGGGTATTCACCCCTCCACTTTGGGAACGGGACCAGGCTCACTGTGACAG3110.1482887195674356No Hit
GGGGAGGGCTGGGTTCATGTAAAGGGGACCAGCATTGTGCCGACAGAGGC3110.1482887195674356No Hit
GGGGATGTAAAGGGTTGGCCCAGAGTGTGTATTCAGGAGGAGGTGCTGAC3090.14733509436121417No Hit
GGGGGTTGTTGTTGCCACCGCTGGAGCAGCCTGTAGCAAGAACAGTCTTG3080.14685828175810342No Hit
GGGACAGAAGTGGCGCCTCTGAGAAAAGAAGGTTGGAATTATCGTAATTT3060.14590465655188198No Hit
GGGGTAAGAAAGGAATACCCGATGATGGAAGTAGCTCTTATGGCTGGAGA3050.14542784394877126No Hit
GGGAGTAAACTCACCTTTGGGACTGGAACAAGACTTCAGGTCACGCTCGA3050.14542784394877126No Hit
GGGAGTGGCTGGAGCATTTGCTGCACAGTTGCATAGGTGTTCAACAATTG3050.14542784394877126No Hit
GGGGAGAAAAAAAAAATGAAGAAGCTACTAGCAATGATTCTGTGGCTTCA2990.1425669683301069No Hit
GGGCTGACTTACTTCCAGAATGAAGCTCAACTAGAAAAATCAAGGCTGCT2990.1425669683301069No Hit
GGGGGAAACCTGCCTGATGTGGGATGTGCTGTGGCTGCTGCTTTGTTGCT2980.14209015572699618No Hit
GGGGATGGCTTTGCAGAGCACTCTGGGGGCGGTGTGGCTAGGGCTTCTCC2980.14209015572699618No Hit
GGGAGGAAACCCTCTGTGCATTGGAGTGATGCTGCTGAGTACTTCTGTGC2960.1411365305207747No Hit
GGGATTCAGGAAATAATTCTTTGCTGATAAGGATGCTCCTTGAACATTTA2950.140659717917664No Hit
GGGGGGGAGTCCGCAGTTCTTCGGGCCAGGGACACGGCTCACCGTGCTAG2950.140659717917664No Hit
GGGAGTCTCAAGATCTCAGACTCACAGCTGGGGGATGCCGCGATGTATTT2940.14018290531455327No Hit
GGGGAGACTGGGGACTCAGCTATCTACTTCTGTGCACAACTCGGGGACAA2940.14018290531455327No Hit
GGGGAACACTGTGTATCTAACTTTGGAAATGAGAAATTAACCTTTGGGAC2930.13970609271144255No Hit
GGGGACCCTCTTGGGCCTGCTTATCCTTTGGCTGCAGCTGCAATGGGTGA2930.13970609271144255No Hit
GGGACACAGATACAGAAGACCCCTCCGTCATGCAGCATCTGCCATGAGCA2920.13922928010833183No Hit
GGGGGGCTTTCTATGGAACTCAAAGTGGGTGGCAGCAAGCACTCTTCTAG2920.13922928010833183No Hit
GGGACCAGACTGCTGGTCAGGCCTGATATCCAGAACCCTGACCCTGCCGT2920.13922928010833183No Hit
GGGGATTGTCATCAGAAATGTGTGACACCTCGAGGGGAGGGGAGGACGTG2910.1387524675052211No Hit
GGGGAGTGTTAGATTAGGTTTCAACCAAGCAAAAGAACCCTGGGAGAAGT2910.1387524675052211No Hit
GGGGAGTACCAAGAGACCCAGTACTTCGGGCCAGGCACGCGGCTCCTGGT2900.13827565490211038No Hit
GGGGGCAGAAGCCTCACACAGCCCAGTAACTTTGCTAGTACCTCTTGAGT2900.13827565490211038No Hit
GGGGACTGTGAGCAACATGAGCCCTGAAGACAGCAGCATATATCTCTGCA2890.13779884229899964No Hit
GGGAGGATATGTAACACAGTGTGATTTATAACCAGGGAGGAAAGCTTATC2890.13779884229899964No Hit
GGGAGTCTCCCAGTCCCCTAGGTACAAAGTCGCAAAGAGAGGACAGGATG2890.13779884229899964No Hit
GGGGTTGTTGAGCAAATCATAGTGTTTCTTCTGGTTCTGCAAGGCAACTG2880.13732202969588891No Hit
GGGAGAGATACTTGATAATATAGCTCTCTTGGCTGGAGATTGCAGGTCCC2870.1368452170927782No Hit
GGGATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCTGCTCTGCTGTGCG2860.13636840448966747No Hit
GGGGACTGATGTCTGTGTAGACAGGGAGCTGTGACGAGAGCAAGAGGTCA2860.13636840448966747No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGGATTCCCGACCA2830.13493796668033528No Hit
GGGGATGATTTTTAAAGTAGAAATATCCATTCTAGGTGCATTTTTTAAGG2830.13493796668033528No Hit
GGGGAGAATACAGGTATGGCAGGGAGGGAAGGAGAAACTTAGGGGGACTG2830.13493796668033528No Hit
GGGGGAGCCATTCTCCATATTTCAGATATAAGATTTCAGTTCTCAGTGAG2820.13446115407722456No Hit
GGGGCTATTTCCCCAGGCAGGGCTGGGAGAGATGAGATCCTGGCCTGGAC2820.13446115407722456No Hit
GGGGAGTTGAGGGTGAATTTACAGAGTTTCAGCTGGTTGGGAAGACTGGA2810.13398434147411384No Hit
GGGGGAGAACCTAAGTTCTATTTCCCCAGGCAGGGCTGGGAGAGATGAGA2810.13398434147411384No Hit
GGGAAAACAAGAGACTTGCCTAGCCCAACCTTCCTCACGCTCGCTATTCT2810.13398434147411384No Hit
GGGGGACTCAGCAATGTACTTCTGTGCAATGAGAGAGGTTAACTTTGGAA2810.13398434147411384No Hit
GGGGGAAAAACGTTTGTTATTATTTTTTTTTCGTGTTTAAGGTTTGAATC2800.13350752887100312No Hit
GGGATAAACATCTGTCTCTGCGCATTGCAGACACCCAGACTGGGGACTCA2780.13255390366478167No Hit
GGGATTCAGAAGCTGACTGGATATTCTGGCAGGCCAAGGATGGAGACTCT2760.1316002784585602No Hit
GGGGGTTTTTCTGCTGTGGGTACGTGAGCAGGAAACATGGAGAAGAATCC2760.1316002784585602No Hit
GGGGTAGAGCAGACTGTGGCTTCTACATCTGCAGTGCTCCGGTCCCGAAC2760.1316002784585602No Hit
GGGGCCTTCCCTCACCCACATGAAGTGTCTACCTTCTGCAGACTACAGTG2750.13112346585544948No Hit
GGGATGTACAAAAGGAATATTAAGCTGTGCAAAATGCTGCTGCGGTGGCC2750.13112346585544948No Hit
GGGGTAGAGCAGACTGTGGCTTTACCTCGGTGTCCTACCAGCAAGGGGTC2740.13064665325233876No Hit
GGGGATTATTTGGGTAACACACTAAAGATGAACTATTCTCCAGGCTTAGT2730.13016984064922804No Hit
GGGGGCTGTGAGTGATCGTAAACTCACGGGAGGAGGAAACAAACTCACCT2710.1292162154430066No Hit
GGGGACATCACTGCAGCCCAGCCTGGTGATACAGGCCTCTACCTCTGTAC2700.12873940283989585No Hit
GGGAGGTTTACAGCACAGCTCAATAAAGCCAGCCAGTATGTTTCTCTGCT2700.12873940283989585No Hit
GGGGGCTCTATCATTGGCTGACAAGATCCTGACAACAACACAATGAGAGC2670.1273089650305637No Hit
GGGGGATCCTGATCTGGTAAAGCTCCCATCCTGCCCTGACCCTGCCATGG2670.1273089650305637No Hit
GGGGATCTGTGACTGAGGAGCCTTGCTCCATTTCAGGTCTTCTGTGATTT2660.12683215242745297No Hit
GGGAGTCAGAGGCCCCATCTCAGACCCGAGGCTAGCATGGGCTGCAGGCT2660.12683215242745297No Hit
GGGGTTGAAGTCAGATTTGCAGCTTTCTAGGCAGGAGACAAGACAATCTG2650.12635533982434224No Hit
GGGATACAGTTAGAGAGAAAGAAAAATGTATCATCAAACCATAGAATAGG2650.12635533982434224No Hit
GGGGAGTTCTCAGTGAGTCTAAGTGACAGAAGGAATGGAGACCCTCTTGG2640.1258785272212315No Hit
GGGGGACCATGCTGGGAATAGACCGCCATAATAAACAGTCTTTTCCGCTG2640.1258785272212315No Hit
GGGGGGGGTTTGCCACACTCATGATGCACTGTGTAGCAATCAGCCCCAGC2640.1258785272212315No Hit
GGGAGACACAGTGCTGCCTGCCCCTTTGTGCCATGGGCTCCAGGCTGCTC2630.12540171461812077No Hit
GGGGATTGCAGACACCCAGACTGGGGACTCAGCTATCTACTTCTGTGCAG2610.12444808941189933No Hit
GGGAAAACAGATGAATTAGACTGACAGGGAGCAAATAGGTAGCAAGGTTT2580.12301765160256715No Hit
GGGACACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATG2570.12254083899945643No Hit
GGGGATCTACTTCTGTGCAGAGACCCATACTCAAACTGGGGCAAACAACC2570.12254083899945643No Hit
GGGGAGATGCCTCTGTGGACAGTTTAAGAAACCACAGTGCTTTGGAGGAA2560.1220640263963457No Hit
GGGGAAGGTCCTGTCCTCCTGGTGACAGTAGTTACGGGTGGAGAAGTGAA2550.12158721379323498No Hit
GGGGAGACAAAGACAAGTGACAAGAATTAGAGGTTTAAAAAGCAACCAGA2530.12063358858701353No Hit
GGGGAAGCACAGAGGAGAACCCATCAGAGCAGGAGACTTTTCACTCTGCA2530.12063358858701353No Hit
GGGGAACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCATCACGGAAGATG2490.11872633817457062No Hit
GGGGTCTCTTCTGCCTGGTTTTTGTTGAGCTTCCTATCACAGTGGAACAC2490.11872633817457062No Hit
GGGGACAATGAGAGCTGCACTCCTTGCAAGTCTTTACTAGTAGCTGTTGC2460.11729590036523845No Hit
GGGAAAGCAGATTCTTTTTATGATTTTTAAAGTAGAAATATCCATTCTAG2450.11681908776212772No Hit
GGGGGACTCAGCAATGTATTTCTGTGCAATGAGAGAGGGCGGAAATAGTG2440.116342275159017No Hit
GGGGGAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCC2430.11586546255590627No Hit
GGGAGAACACATCCAGGCTCCTTAAGGGAAAGCCTCTTTCTGTTTCTGAA2420.11538864995279555No Hit
GGGGCTTTGGTCCAGAGCCATGAATCCAGGCAGAGAAAGGCAGCCATCCT2410.11491183734968483No Hit
GGGGGTATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACT2400.11443502474657409No Hit
GGGGGCCAAAAACATTCAGTACTTCGGCGCCGGGACCCGGCTCTCAGTGC2370.11300458693724191No Hit
GGGGATATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTA2360.11252777433413119No Hit
GGGGAGACTCAACAGTGTCAGTGTAGTGACTAACCCTCCTACTTTTGGTG2350.11205096173102047No Hit
GGGACTTTCCAAAATAGACCGCAACTATTTCTATTGATCTGGAAGAAGCT2340.11157414912790975No Hit
GGGGAAAAACAGAAGACGGAGGGGCTCGGCTCTCCACCTCCACCAGGATT2340.11157414912790975No Hit
GGGGAGGAAAGCTTATCTTCGGACAGGGAACGGAGTTATCTGTGAAACCC2330.11109733652479901No Hit
GGGGCTTTTCTCAGGGGAGAGGCCATCACTTGAAGATGCTGAGTCTTCTG2310.11014371131857757No Hit
GGGGGTTATTATTTTTTTTTCGTGTTTAAGGTTTGAATCCTCAGTGAACC2240.10680602309680248No Hit
GGGGTTGGAGAGGGGTGGGTACTGGAGAAGACCAGCCCCTTCGCCAAACA2240.10680602309680248No Hit
GGGGGAGGCAGTGGTCACAACTCTCCCCAGAGAAGGTGGTGTGAGGCCAT2240.10680602309680248No Hit
GGGAGGCTGACCGTACTGGGTAAGGAGGCGGTTGGGGCTCCGGAGAGCTC2240.10680602309680248No Hit
GGGGTTTCAGCTGGTTGGGAAGACTGGAAGACCACCTGGGCTGTCATTGA2230.10632921049369176No Hit
GGGGGGAAACCCTCTGTGCATTGGAGTGATGCTGCTGAGTACTTCTGTGC2200.10489877268435958No Hit
GGGGGAGAGTCCTGCTCCCCTTTCATCAATGCACAGATACAGAAGACCCC2200.10489877268435958No Hit
GGGGACAGTGGCTCAGGAACCGGGGATGCAGTGCCAGGCTCATGGTATCC2190.10442196008124886No Hit
GGGTGAGCAGAGGAGAGAGTGTGGGGCTGCATCTTCCTACCCTGAGTGTC2180.10394514747813814No Hit
GGGATTGTGCCTTCCTACGTTCTGGGGGATAGGGGGGCCACCGATAAACT2180.10394514747813814No Hit
GGGGATAACTGGAGGTTGCAGGTCAATGACTGATCTTAATTGGGAAGAAC2140.10203789706569523No Hit
GGGAGGGCGGATCTGAAAAGCTGGTCTTTGGAAAGGGAACGAAACTGACA2130.10156108446258451No Hit
GGGGGACAACTCCTCAGCCTTAACCATCTAGTCAGCACCCCATGACCAAC2130.10156108446258451No Hit
GGGGACAGTGTGATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGG2110.10060745925636305No Hit

[OK]Adapter Content

Adapter graph