FastQCFastQC Report
Fri 31 May 2024
EGAF00005489002

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00005489002
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3536496
Total Bases357.1 Mbp
Sequences flagged as poor quality0
Sequence length101
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTCT90640.25629889020092206No Hit
CTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCC74740.21133913342472324No Hit
GCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCA73710.20842664603607639No Hit
GTTGTCTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTAT71320.20166854423135216No Hit
GGGGAAGAAAAGAAGGGGAAGAAGATCAAAACCCACCATGCCCCAGGCTC64440.18221425953825482No Hit
CAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATAT57870.16363654871941039No Hit
AGAAGATCAAAACCCACCATGCCCCAGGCTCAGCAGGGAGCTGCTGGATG56500.15976265772674422No Hit
CTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTC56450.1596212748438002No Hit
CTTGAACAGCCTGACTCCTGCCAGCCCTATGGAAGTTCCTTTTATGCATT55640.15733087214010705No Hit
TGTTATTCAACTCCTTCCAGTTGTCTTGAACAGCCTGACTCCTGCCAGCC50580.1430229243861721No Hit
GGAAGTTCCTTTTATGCATTGGAGGAAAAACATGTTGGCTTTTCTCTTGA49210.13914903339350587No Hit
TGTTATTCGACTCCTTCAGGTTATCTTGAACTGCCTGACTTAGGCCAGCC46360.13109020906569666No Hit
GAGAAATTGAAAAGAAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATCA46170.13055295411050938No Hit
GTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCA45670.12913912528106916No Hit
AGAAGATCAAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGA44950.12710321176667527No Hit
CAAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGATCAAAAC44240.12509557482887015No Hit
GCCTGAAGTCTTGCAGGACTCACTGGATAGATGTTATTCAACTCCTTCCA41770.11811126041143549No Hit
GTCTTGCAGGACTCACTGGATAGATGTTATTCAACTCCTTCCAGTTGTCT41520.11740434599671538No Hit
CTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCT40250.11381322076993725No Hit
TGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCT39650.11211662617460899No Hit
GTTATCTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTAC38930.11008071266021507No Hit
GCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAA37510.10606543878460488No Hit
GTTCCTTTTATGCATTGGAGGAAAAACATGTTGGCTTTTCTCTTGACGTG37140.10501920545081911No Hit
CCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAG36870.1042557378829214No Hit
TGTTATTCAACTCCTTCAGGTTGTCTTGAACTGACTGACTCATGCCAGCC36360.10281363247689237No Hit
CTTGAACTGACTGACTCATGCCAGCCCTACAGAAGTGCCTTTTATGTATT36260.10253086671100434No Hit
GCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCG35750.10108876130497531No Hit

[OK]Adapter Content

Adapter graph