FastQCFastQC Report
Fri 31 May 2024
EGAF00005489012

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00005489012
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2831951
Total Bases286 Mbp
Sequences flagged as poor quality0
Sequence length101
%GC53

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAG57340.20247525469190678No Hit
CCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTCT53110.18753855557529067No Hit
CTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTC51930.18337181681462708No Hit
CTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCT50340.17775731289136004No Hit
GCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCA49170.1736258854761258No Hit
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA48980.1729549699129681No Hit
GGGGAAGAAAAGAAGGGGAAGAAGATCAAAACCCACCATGCCCCAGGCTC40240.1420928540077141No Hit
CAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATAT39820.14060977749968132No Hit
TGTTATTCGACTCCTTCAGGTTATCTTGAACTGCCTGACTTAGGCCAGCC39550.1396563711730888No Hit
GTTGTCTTGAACTGACTGACTCATGCCAGCCCTACAGAAGTGCCTTTTAC39440.13926794637336593No Hit
GTCTAACACGTGCGCGAGTCGGGGGCTCGCACGAAAGCCGCCGTGGCGCA36780.1298751284891582No Hit
GGAGTCTAACACGTGCGCGAGTCGGGGGCTCGCACGAAAGCCGCCGTGGC35830.1265205506733697No Hit
GTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAA35620.1257790124193533No Hit
CATGGATGAAATTGAAAAGTACCAAGAAGTGGAAGAAGACCAAGACCCAT34770.12277754805785834No Hit
GAGAAATTGAAAAGAAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATCA34180.12069417867752656No Hit
CTTGAACTGCCTGACTTAGGCCAGCCCTACAGCAGTGCTGTTTACTCATT34040.12019981984151562No Hit
GTGAAATTCTTGGACCGGCGCAAGACGGACCAGAGCGAAAGCATTTGCCA30660.1082645850863945No Hit
CTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCC30210.10667557454207363No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN29720.10494531861603537No Hit
TCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTC28780.10162605214567624No Hit
CTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTC28390.10024890967393149No Hit

[OK]Adapter Content

Adapter graph