FastQCFastQC Report
Fri 3 May 2024
EGAF00006176506

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00006176506
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences848616849
Total Bases127.2 Gbp
Sequences flagged as poor quality0
Sequence length150
%GC44

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG63526120.7485842412256889Illumina Single End PCR Primer 1 (100% over 50bp)

[WARN]Adapter Content

Adapter graph