FastQCFastQC Report
Sun 12 May 2024
EGAF00006419142

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00006419142
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences43727138
Total Bases5.4 Gbp
Sequences flagged as poor quality0
Sequence length125
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC32063597.332652322226075TruSeq Adapter, Index 2 (100% over 50bp)

[WARN]Adapter Content

Adapter graph