FastQCFastQC Report
Mon 20 May 2024
EGAF00007916506

Summary

[OK]Basic Statistics

MeasureValue
FilenameEGAF00007916506
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences171024389
Total Bases16.7 Gbp
Sequences flagged as poor quality0
Sequence length98
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT10713890.6264539264046135No Hit
ACACACACACACACACACACACACACACACACACACACACACACACACAC2502520.1463253290733873No Hit
AAGCAGTGGTATCAACGCAGAGTACATGGGAAAAAAAAAAAAAAAAAAAA2461000.1438976051538474Clontech SMARTer II A Oligonucleotide (100% over 25bp)
AAGCAGTGGTATCAACGCAGAGTACATGGGACACACACACACACACACAC1737520.10159486668302029Clontech SMARTer II A Oligonucleotide (100% over 25bp)

[OK]Adapter Content

Adapter graph