FastQCFastQC Report
Wed 22 May 2024


[OK]Basic Statistics

File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences141551385
Total Bases12.8 Gbp
Sequences flagged as poor quality0
Sequence length91

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per tile quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AAGCAGTGGTATCAACGCAGAGTACATGGGATAAACTTCGCCTTAATTTT2624080.18538003001524853Clontech SMARTer II A Oligonucleotide (100% over 25bp)

[OK]Adapter Content

Adapter graph